EMAIL THIS PAGE TO A FRIEND

LRRC3B

leucine rich repeat containing 3B

71 Gene Product Result for
Synonyms: LRP15
UniProtKB ID: Q96PB8, Q5M8T0
Gene ID:
Mouse(218763) leucine rich repeat containing 3B
Rat(305705) leucine rich repeat containing 3B
Zebrafish(100037364) leucine rich repeat containing 3B
cow(783571) leucine rich repeat containing 3B
chicken(420657) leucine rich repeat containing 3B
dog(485639) leucine rich repeat containing 3B
domestic cat(101086594) leucine rich repeat containing 3B
naked mole-rat(101698036) leucine rich repeat containing 3B
domestic guinea pig(100720313) leucine rich repeat containing 3B
sheep(101121397) leucine rich repeat containing 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052953 Rosetta Predictions human pricing
XM_223808 Rosetta Predictions rat pricing
XR_008527 Rosetta Predictions rat pricing
NM_146052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361752 predicted 1329
2 SASI_Hs01_00128689 predicted 1233
3 SASI_Hs01_00128690 predicted 780
4 SASI_Hs01_00128692 predicted 952
5 SASI_Hs02_00361753 predicted 1228
6 SASI_Hs01_00128693 predicted 774
7 SASI_Hs01_00128694 predicted 1212
8 SASI_Hs01_00128695 predicted 916
9 SASI_Hs01_00128696 predicted 785
10 SASI_Hs01_00128697 predicted 1390
11 SASI_Hs01_00128688 predicted 778
12 SASI_Hs01_00128691 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193570 predicted 1353
2 SASI_Rn01_00193571 predicted 1089
3 SASI_Rn01_00193572 predicted 1439
4 SASI_Rn01_00193573 predicted 1460
5 SASI_Rn01_00193574 predicted 1192
6 SASI_Rn01_00193575 predicted 1079
7 SASI_Rn01_00193576 predicted 1154
8 SASI_Rn01_00193577 predicted 789
9 SASI_Rn01_00193578 predicted 1334
10 SASI_Rn01_00193579 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131004 predicted 1639
2 SASI_Rn02_00417265 predicted 201
3 SASI_Rn01_00131006 predicted 1733
4 SASI_Rn02_00417266 predicted 1719
5 SASI_Rn01_00131007 predicted 1751
6 SASI_Rn02_00417267 predicted 1674
7 SASI_Rn02_00417268 predicted 300
8 SASI_Rn02_00417269 predicted 294
9 SASI_Rn02_00417270 predicted 216
10 SASI_Rn02_00417271 predicted 311
11 SASI_Rn01_00131003 predicted 1256
12 SASI_Rn01_00131005 predicted 1395
13 SASI_Rn01_00131008 predicted 1492
14 SASI_Rn01_00131009 predicted 1379
15 SASI_Rn01_00131010 predicted 1454
16 SASI_Rn01_00131011 predicted 1095
17 SASI_Rn01_00131012 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167500 predicted 957
2 SASI_Mm01_00167501 predicted 1211
3 SASI_Mm01_00167502 predicted 1056
4 SASI_Mm01_00167503 predicted 934
5 SASI_Mm01_00167504 predicted 493
6 SASI_Mm01_00167505 predicted 748
7 SASI_Mm01_00167506 predicted 765
8 SASI_Mm01_00167507 predicted 1148
9 SASI_Mm01_00167508 predicted 861
10 SASI_Mm01_00167509 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052953
LRRC3B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 3B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-949s21c1
Sequence:CCGGGTCCGACAATCGGATTCAAAGCTCGAGCTTTGAATCCGATTGTCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052953.2-1378s1c1
Sequence:CCGGCTGACTGTCATTGAGAAAGAACTCGAGTTCTTTCTCAATGACAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-656s1c1
Sequence:CCGGCTTATGATACTGTGCTTTCATCTCGAGATGAAAGCACAGTATCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-1217s21c1
Sequence:CCGGATGTTTGGCTGGTTCACTATGCTCGAGCATAGTGAACCAGCCAAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-806s21c1
Sequence:CCGGTCCAATCAGATCACATCTATTCTCGAGAATAGATGTGATCTGATTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-1166s1c1
Sequence:CCGGGACCTTTGTAACCTCCCTAAACTCGAGTTTAGGGAGGTTACAAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-1037s1c1
Sequence:CCGGGACTGTACTCTACAGCAAGTTCTCGAGAACTTGCTGTAGAGTACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-779s1c1
Sequence:CCGGCCTGAAACAGTCTTACTGTATCTCGAGATACAGTAAGACTGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052953.2-1417s1c1
Sequence:CCGGGCAGTAGAAATAAGTGGTTTACTCGAGTAAACCACTTATTTCTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-731s1c1
Sequence:CCGGGTCACCTGTAGCAATGCAAATCTCGAGATTTGCATTGCTACAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052953
LRRC3B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 3B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-949s21c1
Sequence:CCGGGTCCGACAATCGGATTCAAAGCTCGAGCTTTGAATCCGATTGTCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052953.2-1378s1c1
Sequence:CCGGCTGACTGTCATTGAGAAAGAACTCGAGTTCTTTCTCAATGACAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-656s1c1
Sequence:CCGGCTTATGATACTGTGCTTTCATCTCGAGATGAAAGCACAGTATCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-1217s21c1
Sequence:CCGGATGTTTGGCTGGTTCACTATGCTCGAGCATAGTGAACCAGCCAAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-806s21c1
Sequence:CCGGTCCAATCAGATCACATCTATTCTCGAGAATAGATGTGATCTGATTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-1166s1c1
Sequence:CCGGGACCTTTGTAACCTCCCTAAACTCGAGTTTAGGGAGGTTACAAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-1037s1c1
Sequence:CCGGGACTGTACTCTACAGCAAGTTCTCGAGAACTTGCTGTAGAGTACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-779s1c1
Sequence:CCGGCCTGAAACAGTCTTACTGTATCTCGAGATACAGTAAGACTGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052953.2-1417s1c1
Sequence:CCGGGCAGTAGAAATAAGTGGTTTACTCGAGTAAACCACTTATTTCTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-731s1c1
Sequence:CCGGGTCACCTGTAGCAATGCAAATCTCGAGATTTGCATTGCTACAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052953
LRRC3B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 3B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-949s21c1
Sequence:CCGGGTCCGACAATCGGATTCAAAGCTCGAGCTTTGAATCCGATTGTCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052953.2-1378s1c1
Sequence:CCGGCTGACTGTCATTGAGAAAGAACTCGAGTTCTTTCTCAATGACAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-656s1c1
Sequence:CCGGCTTATGATACTGTGCTTTCATCTCGAGATGAAAGCACAGTATCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-1217s21c1
Sequence:CCGGATGTTTGGCTGGTTCACTATGCTCGAGCATAGTGAACCAGCCAAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052953.2-806s21c1
Sequence:CCGGTCCAATCAGATCACATCTATTCTCGAGAATAGATGTGATCTGATTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-1166s1c1
Sequence:CCGGGACCTTTGTAACCTCCCTAAACTCGAGTTTAGGGAGGTTACAAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-1037s1c1
Sequence:CCGGGACTGTACTCTACAGCAAGTTCTCGAGAACTTGCTGTAGAGTACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-779s1c1
Sequence:CCGGCCTGAAACAGTCTTACTGTATCTCGAGATACAGTAAGACTGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052953.2-1417s1c1
Sequence:CCGGGCAGTAGAAATAAGTGGTTTACTCGAGTAAACCACTTATTTCTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052953.2-731s1c1
Sequence:CCGGGTCACCTGTAGCAATGCAAATCTCGAGATTTGCATTGCTACAGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146052
LRRC3B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-1068s21c1
Sequence:CCGGTATGCCATGCTCGTCACTATGCTCGAGCATAGTGACGAGCATGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146052.3-1366s21c1
Sequence:CCGGCTTTACACAAACAACACTAATCTCGAGATTAGTGTTGTTTGTGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-1151s21c1
Sequence:CCGGTGCCCGGAGACACCTTGAATACTCGAGTATTCAAGGTGTCTCCGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-579s21c1
Sequence:CCGGTCTTCCTCTGGAGGGTTAAATCTCGAGATTTAACCCTCCAGAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-818s21c1
Sequence:CCGGGTCTGACAACAGGATTCAAAGCTCGAGCTTTGAATCCTGTTGTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146052
LRRC3B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-1068s21c1
Sequence:CCGGTATGCCATGCTCGTCACTATGCTCGAGCATAGTGACGAGCATGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146052.3-1366s21c1
Sequence:CCGGCTTTACACAAACAACACTAATCTCGAGATTAGTGTTGTTTGTGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-1151s21c1
Sequence:CCGGTGCCCGGAGACACCTTGAATACTCGAGTATTCAAGGTGTCTCCGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-579s21c1
Sequence:CCGGTCTTCCTCTGGAGGGTTAAATCTCGAGATTTAACCCTCCAGAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-818s21c1
Sequence:CCGGGTCTGACAACAGGATTCAAAGCTCGAGCTTTGAATCCTGTTGTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146052
LRRC3B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-1068s21c1
Sequence:CCGGTATGCCATGCTCGTCACTATGCTCGAGCATAGTGACGAGCATGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146052.3-1366s21c1
Sequence:CCGGCTTTACACAAACAACACTAATCTCGAGATTAGTGTTGTTTGTGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-1151s21c1
Sequence:CCGGTGCCCGGAGACACCTTGAATACTCGAGTATTCAAGGTGTCTCCGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-579s21c1
Sequence:CCGGTCTTCCTCTGGAGGGTTAAATCTCGAGATTTAACCCTCCAGAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146052.3-818s21c1
Sequence:CCGGGTCTGACAACAGGATTCAAAGCTCGAGCTTTGAATCCTGTTGTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)