EMAIL THIS PAGE TO A FRIEND

LRRC40

leucine rich repeat containing 40

66 Gene Product Result for
Synonyms: dJ677H15.1
UniProtKB ID: Q9H9A6, Q9BTR7, Q9NSK1, Q9NXC1
Gene ID:
Mouse(67144) leucine rich repeat containing 40
Rat(310946) leucine rich repeat containing 40
Zebrafish(334130) leucine rich repeat containing 40
chicken(424713) leucine rich repeat containing 40
dog(490217) leucine rich repeat containing 40
domestic cat(101087252) leucine rich repeat containing 40
cow(526961) leucine rich repeat containing 40
sheep(101117711) leucine rich repeat containing 40
Domestic Rabbit(100351765) leucine rich repeat containing 40
naked mole-rat(101721431) leucine rich repeat containing 40
domestic guinea pig(100718447) leucine rich repeat containing 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017768 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017768 Rosetta Predictions human pricing
NM_001034926 Rosetta Predictions rat pricing
NM_024194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155159 predicted 516
2 SASI_Hs01_00155160 predicted 846
3 SASI_Hs01_00155161 predicted 1210
4 SASI_Hs01_00155165 predicted 1117
5 SASI_Hs02_00350599 predicted 444
6 SASI_Hs01_00155166 predicted 1352
7 SASI_Hs01_00155167 predicted 1525
8 SASI_Hs02_00350600 predicted 222
9 SASI_Hs01_00155168 predicted 1099
10 SASI_Hs02_00350601 predicted 1853
11 SASI_Hs01_00155162 predicted 720
12 SASI_Hs01_00155163 predicted 1517
13 SASI_Hs01_00155164 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204077 predicted 525
2 SASI_Rn02_00204078 predicted 648
3 SASI_Rn02_00204079 predicted 459
4 SASI_Rn02_00204080 predicted 1090
5 SASI_Rn02_00204081 predicted 381
6 SASI_Rn02_00204082 predicted 394
7 SASI_Rn02_00204083 predicted 814
8 SASI_Rn02_00204084 predicted 1156
9 SASI_Rn02_00204085 predicted 544
10 SASI_Rn02_00204086 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188259 predicted 1821
2 SASI_Mm01_00188260 predicted 743
3 SASI_Mm01_00188261 predicted 1359
4 SASI_Mm01_00188262 predicted 541
5 SASI_Mm01_00188263 predicted 535
6 SASI_Mm01_00188264 predicted 411
7 SASI_Mm01_00188265 predicted 1217
8 SASI_Mm01_00188266 predicted 1052
9 SASI_Mm01_00188267 predicted 1767
10 SASI_Mm01_00188268 predicted 1063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024194
VALIDATED
LRRC40 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 40
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024194.2-3046s1c1
Sequence:CCGGGCAGAGTTGAAATACAGGTTACTCGAGTAACCTGTATTTCAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-1219s1c1
Sequence:CCGGGCCACACTAAAGCTGCTAGATCTCGAGATCTAGCAGCTTTAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-340s1c1
Sequence:CCGGGCCCTTACTGTTCTTGATATACTCGAGTATATCAAGAACAGTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-660s1c1
Sequence:CCGGGCCAGCAGAAATAAGCAGAATCTCGAGATTCTGCTTATTTCTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-417s1c1
Sequence:CCGGGAAACTTAATGTCAGCCATAACTCGAGTTATGGCTGACATTAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024194.5-2127s21c1
Sequence:CCGGTGAACTGAGCAAGACTATATACTCGAGTATATAGTCTTGCTCAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-1114s21c1
Sequence:CCGGACCTGCGCAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTGCGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-339s21c1
Sequence:CCGGGCCCTTACTGTTCTTGATATACTCGAGTATATCAAGAACAGTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-659s21c1
Sequence:CCGGGCCAGCAGAAATAAGCAGAATCTCGAGATTCTGCTTATTTCTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-1218s21c1
Sequence:CCGGGCCACACTAAAGCTGCTAGATCTCGAGATCTAGCAGCTTTAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024194
VALIDATED
LRRC40 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 40
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024194.2-3046s1c1
Sequence:CCGGGCAGAGTTGAAATACAGGTTACTCGAGTAACCTGTATTTCAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-1219s1c1
Sequence:CCGGGCCACACTAAAGCTGCTAGATCTCGAGATCTAGCAGCTTTAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-340s1c1
Sequence:CCGGGCCCTTACTGTTCTTGATATACTCGAGTATATCAAGAACAGTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-660s1c1
Sequence:CCGGGCCAGCAGAAATAAGCAGAATCTCGAGATTCTGCTTATTTCTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-417s1c1
Sequence:CCGGGAAACTTAATGTCAGCCATAACTCGAGTTATGGCTGACATTAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024194.5-2127s21c1
Sequence:CCGGTGAACTGAGCAAGACTATATACTCGAGTATATAGTCTTGCTCAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-1114s21c1
Sequence:CCGGACCTGCGCAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTGCGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-339s21c1
Sequence:CCGGGCCCTTACTGTTCTTGATATACTCGAGTATATCAAGAACAGTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-659s21c1
Sequence:CCGGGCCAGCAGAAATAAGCAGAATCTCGAGATTCTGCTTATTTCTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-1218s21c1
Sequence:CCGGGCCACACTAAAGCTGCTAGATCTCGAGATCTAGCAGCTTTAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024194
VALIDATED
LRRC40 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 40
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024194.2-3046s1c1
Sequence:CCGGGCAGAGTTGAAATACAGGTTACTCGAGTAACCTGTATTTCAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-1219s1c1
Sequence:CCGGGCCACACTAAAGCTGCTAGATCTCGAGATCTAGCAGCTTTAGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-340s1c1
Sequence:CCGGGCCCTTACTGTTCTTGATATACTCGAGTATATCAAGAACAGTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-660s1c1
Sequence:CCGGGCCAGCAGAAATAAGCAGAATCTCGAGATTCTGCTTATTTCTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024194.2-417s1c1
Sequence:CCGGGAAACTTAATGTCAGCCATAACTCGAGTTATGGCTGACATTAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024194.5-2127s21c1
Sequence:CCGGTGAACTGAGCAAGACTATATACTCGAGTATATAGTCTTGCTCAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-1114s21c1
Sequence:CCGGACCTGCGCAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTGCGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-339s21c1
Sequence:CCGGGCCCTTACTGTTCTTGATATACTCGAGTATATCAAGAACAGTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-659s21c1
Sequence:CCGGGCCAGCAGAAATAAGCAGAATCTCGAGATTCTGCTTATTTCTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024194.5-1218s21c1
Sequence:CCGGGCCACACTAAAGCTGCTAGATCTCGAGATCTAGCAGCTTTAGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017768
VALIDATED
LRRC40 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 40
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017768.3-688s1c1
Sequence:CCGGGCCAGCAGAAATAAATAGAATCTCGAGATTCTATTTATTTCTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-1732s1c1
Sequence:CCGGGCTCGGTAATTGTGTAAACTTCTCGAGAAGTTTACACAATTACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017768.3-2134s1c1
Sequence:CCGGGCTTATGATTTATCCTGCTAACTCGAGTTAGCAGGATAAATCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-207s1c1
Sequence:CCGGCGCAGTGTGTCTGGAGAATAACTCGAGTTATTCTCCAGACACACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-802s1c1
Sequence:CCGGGCGGAGGAATAAATTACGTTTCTCGAGAAACGTAATTTATTCCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1005s21c1
Sequence:CCGGACCTAAGCAACAATGATATTACTCGAGTAATATCATTGTTGCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1722s21c1
Sequence:CCGGTTCCACCAGAGCTCGGTAATTCTCGAGAATTACCGAGCTCTGGTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-207s21c1
Sequence:CCGGCGCAGTGTGTCTGGAGAATAACTCGAGTTATTCTCCAGACACACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1987s21c1
Sequence:CCGGATCACCTACCCGTTGGTATAACTCGAGTTATACCAACGGGTAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1143s21c1
Sequence:CCGGATCTACGAAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTTCGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017768
VALIDATED
LRRC40 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 40
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017768.3-688s1c1
Sequence:CCGGGCCAGCAGAAATAAATAGAATCTCGAGATTCTATTTATTTCTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-1732s1c1
Sequence:CCGGGCTCGGTAATTGTGTAAACTTCTCGAGAAGTTTACACAATTACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017768.3-2134s1c1
Sequence:CCGGGCTTATGATTTATCCTGCTAACTCGAGTTAGCAGGATAAATCATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-207s1c1
Sequence:CCGGCGCAGTGTGTCTGGAGAATAACTCGAGTTATTCTCCAGACACACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-802s1c1
Sequence:CCGGGCGGAGGAATAAATTACGTTTCTCGAGAAACGTAATTTATTCCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1005s21c1
Sequence:CCGGACCTAAGCAACAATGATATTACTCGAGTAATATCATTGTTGCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1722s21c1
Sequence:CCGGTTCCACCAGAGCTCGGTAATTCTCGAGAATTACCGAGCTCTGGTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-207s21c1
Sequence:CCGGCGCAGTGTGTCTGGAGAATAACTCGAGTTATTCTCCAGACACACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1987s21c1
Sequence:CCGGATCACCTACCCGTTGGTATAACTCGAGTTATACCAACGGGTAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1143s21c1
Sequence:CCGGATCTACGAAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTTCGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017768
VALIDATED
LRRC40 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 40
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_017768.3-688s1c1
Sequence:CCGGGCCAGCAGAAATAAATAGAATCTCGAGATTCTATTTATTTCTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-1732s1c1
Sequence:CCGGGCTCGGTAATTGTGTAAACTTCTCGAGAAGTTTACACAATTACCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017768.3-2134s1c1
Sequence:CCGGGCTTATGATTTATCCTGCTAACTCGAGTTAGCAGGATAAATCATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-207s1c1
Sequence:CCGGCGCAGTGTGTCTGGAGAATAACTCGAGTTATTCTCCAGACACACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017768.3-802s1c1
Sequence:CCGGGCGGAGGAATAAATTACGTTTCTCGAGAAACGTAATTTATTCCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1005s21c1
Sequence:CCGGACCTAAGCAACAATGATATTACTCGAGTAATATCATTGTTGCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1722s21c1
Sequence:CCGGTTCCACCAGAGCTCGGTAATTCTCGAGAATTACCGAGCTCTGGTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-207s21c1
Sequence:CCGGCGCAGTGTGTCTGGAGAATAACTCGAGTTATTCTCCAGACACACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1987s21c1
Sequence:CCGGATCACCTACCCGTTGGTATAACTCGAGTTATACCAACGGGTAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_017768.3-1143s21c1
Sequence:CCGGATCTACGAAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTTCGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)