EMAIL THIS PAGE TO A FRIEND

LRRC41

leucine rich repeat containing 41

82 Gene Product Result for
Synonyms: MUF1 RP4-636H5.2
UniProtKB ID: Q15345, A8K5G8, Q3MJ96, Q5TDF5, Q71RA8, Q9BSM0
Gene ID:
Mouse(230654) leucine rich repeat containing 41
Rat(362566) leucine rich repeat containing 41
domestic guinea pig(100732997) leucine rich repeat containing 41
naked mole-rat(101719267) leucine rich repeat containing 41
Domestic Rabbit(100344237) leucine rich repeat containing 41
sheep(101112107) leucine rich repeat containing 41
chicken(424612) leucine rich repeat containing 41
dog(608535) leucine rich repeat containing 41
domestic cat(101094776) leucine rich repeat containing 41
cow(337889) leucine rich repeat containing 41
Horse(100051941) leucine rich repeat containing 41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006369 Rosetta Predictions human pricing
NM_001009710 Rosetta Predictions rat pricing
NM_153521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114576 predicted 868
2 SASI_Hs01_00114577 predicted 2105
3 SASI_Hs01_00114578 predicted 313
4 SASI_Hs01_00114579 predicted 2054
5 SASI_Hs02_00341430 predicted 1003
6 SASI_Hs01_00114580 predicted 1263
7 SASI_Hs01_00114581 predicted 479
8 SASI_Hs01_00114582 predicted 268
9 SASI_Hs01_00114583 predicted 456
10 SASI_Hs01_00114584 predicted 2251
11 SASI_Hs01_00114585 predicted 1872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092804 predicted 263
2 SASI_Rn01_00092805 predicted 2097
3 SASI_Rn02_00199772 predicted 2314
4 SASI_Rn01_00092806 predicted 1429
5 SASI_Rn01_00092807 predicted 2082
6 SASI_Rn01_00092808 predicted 1252
7 SASI_Rn01_00092809 predicted 480
8 SASI_Rn01_00092810 predicted 2236
9 SASI_Rn01_00092811 predicted 413
10 SASI_Rn01_00092812 predicted 454
11 SASI_Rn01_00092813 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045114 predicted 2003
2 SASI_Mm01_00045115 predicted 1798
3 SASI_Mm01_00045116 predicted 1946
4 SASI_Mm01_00045117 predicted 362
5 SASI_Mm01_00045118 predicted 1155
6 SASI_Mm01_00045119 predicted 1422
7 SASI_Mm01_00045120 predicted 318
8 SASI_Mm01_00045121 predicted 773
9 SASI_Mm02_00343279 predicted 266
10 SASI_Mm01_00045122 predicted 502
11 SASI_Mm01_00045113 predicted 2466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006369
VALIDATED
LRRC41 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 41
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1427s21c1
Sequence:CCGGCATCTCCACCTTGGAGCTATTCTCGAGAATAGCTCCAAGGTGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-1664s1c1
Sequence:CCGGCATCTCCACCTTGGAGCTATTCTCGAGAATAGCTCCAAGGTGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-631s1c1
Sequence:CCGGGTTTGGAAAGTGTGACATGTTCTCGAGAACATGTCACACTTTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-2189s1c1
Sequence:CCGGGCAAACACTCAAAGAGTACAACTCGAGTTGTACTCTTTGAGTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-2297s1c1
Sequence:CCGGGCAAGAGATTACCTTCTCCTTCTCGAGAAGGAGAAGGTAATCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-2202s1c1
Sequence:CCGGGAGTACAACCTAGCCCTGAAACTCGAGTTTCAGGGCTAGGTTGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-505s1c1
Sequence:CCGGGCATCCTACCTCTGCTCAATACTCGAGTATTGAGCAGAGGTAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-657s1c1
Sequence:CCGGGCCAAGTTTATGGAGGCCTTTCTCGAGAAAGGCCTCCATAAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-2794s1c1
Sequence:CCGGCCCAACCACCAGTTCTATCTTCTCGAGAAGATAGAACTGGTGGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1952s21c1
Sequence:CCGGGCAAACACTCAAAGAGTACAACTCGAGTTGTACTCTTTGAGTGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006369.3-2932s1c1
Sequence:CCGGCCTTACTCAGTATCCTGGGAACTCGAGTTCCCAGGATACTGAGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-1557s1c1
Sequence:CCGGGATGGCGAAGAGATGGAGATTCTCGAGAATCTCCATCTCTTCGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1965s21c1
Sequence:CCGGGAGTACAACCTAGCCCTGAAACTCGAGTTTCAGGGCTAGGTTGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006369.4-2557s21c1
Sequence:CCGGCCCAACCACCAGTTCTATCTTCTCGAGAAGATAGAACTGGTGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006369
VALIDATED
LRRC41 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 41
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1427s21c1
Sequence:CCGGCATCTCCACCTTGGAGCTATTCTCGAGAATAGCTCCAAGGTGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-1664s1c1
Sequence:CCGGCATCTCCACCTTGGAGCTATTCTCGAGAATAGCTCCAAGGTGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-631s1c1
Sequence:CCGGGTTTGGAAAGTGTGACATGTTCTCGAGAACATGTCACACTTTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-2189s1c1
Sequence:CCGGGCAAACACTCAAAGAGTACAACTCGAGTTGTACTCTTTGAGTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-2297s1c1
Sequence:CCGGGCAAGAGATTACCTTCTCCTTCTCGAGAAGGAGAAGGTAATCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-2202s1c1
Sequence:CCGGGAGTACAACCTAGCCCTGAAACTCGAGTTTCAGGGCTAGGTTGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-505s1c1
Sequence:CCGGGCATCCTACCTCTGCTCAATACTCGAGTATTGAGCAGAGGTAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-657s1c1
Sequence:CCGGGCCAAGTTTATGGAGGCCTTTCTCGAGAAAGGCCTCCATAAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-2794s1c1
Sequence:CCGGCCCAACCACCAGTTCTATCTTCTCGAGAAGATAGAACTGGTGGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1952s21c1
Sequence:CCGGGCAAACACTCAAAGAGTACAACTCGAGTTGTACTCTTTGAGTGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006369.3-2932s1c1
Sequence:CCGGCCTTACTCAGTATCCTGGGAACTCGAGTTCCCAGGATACTGAGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-1557s1c1
Sequence:CCGGGATGGCGAAGAGATGGAGATTCTCGAGAATCTCCATCTCTTCGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1965s21c1
Sequence:CCGGGAGTACAACCTAGCCCTGAAACTCGAGTTTCAGGGCTAGGTTGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006369.4-2557s21c1
Sequence:CCGGCCCAACCACCAGTTCTATCTTCTCGAGAAGATAGAACTGGTGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006369
VALIDATED
LRRC41 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 41
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1427s21c1
Sequence:CCGGCATCTCCACCTTGGAGCTATTCTCGAGAATAGCTCCAAGGTGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-1664s1c1
Sequence:CCGGCATCTCCACCTTGGAGCTATTCTCGAGAATAGCTCCAAGGTGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-631s1c1
Sequence:CCGGGTTTGGAAAGTGTGACATGTTCTCGAGAACATGTCACACTTTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-2189s1c1
Sequence:CCGGGCAAACACTCAAAGAGTACAACTCGAGTTGTACTCTTTGAGTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-2297s1c1
Sequence:CCGGGCAAGAGATTACCTTCTCCTTCTCGAGAAGGAGAAGGTAATCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-2202s1c1
Sequence:CCGGGAGTACAACCTAGCCCTGAAACTCGAGTTTCAGGGCTAGGTTGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-505s1c1
Sequence:CCGGGCATCCTACCTCTGCTCAATACTCGAGTATTGAGCAGAGGTAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-657s1c1
Sequence:CCGGGCCAAGTTTATGGAGGCCTTTCTCGAGAAAGGCCTCCATAAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006369.3-2794s1c1
Sequence:CCGGCCCAACCACCAGTTCTATCTTCTCGAGAAGATAGAACTGGTGGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1952s21c1
Sequence:CCGGGCAAACACTCAAAGAGTACAACTCGAGTTGTACTCTTTGAGTGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006369.3-2932s1c1
Sequence:CCGGCCTTACTCAGTATCCTGGGAACTCGAGTTCCCAGGATACTGAGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006369.3-1557s1c1
Sequence:CCGGGATGGCGAAGAGATGGAGATTCTCGAGAATCTCCATCTCTTCGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006369.4-1965s21c1
Sequence:CCGGGAGTACAACCTAGCCCTGAAACTCGAGTTTCAGGGCTAGGTTGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006369.4-2557s21c1
Sequence:CCGGCCCAACCACCAGTTCTATCTTCTCGAGAAGATAGAACTGGTGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153521
LRRC41 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 41
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-1585s1c1
Sequence:CCGGCCTGTCTATTCGTGTTGACCACTCGAGTGGTCAACACGAATAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-373s1c1
Sequence:CCGGGTCTTCTGATAAACGTCTTTGCTCGAGCAAAGACGTTTATCAGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153521.1-2469s21c1
Sequence:CCGGTTCTGCCACTTTGTCTATTTCCTCGAGGAAATAGACAAAGTGGCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-830s21c1
Sequence:CCGGCGATGTGCTGCTGCACTAATGCTCGAGCATTAGTGCAGCAGCACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-170s21c1
Sequence:CCGGATCTTACCTCTGCTCAATATACTCGAGTATATTGAGCAGAGGTAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-772s21c1
Sequence:CCGGTAGAGATGAAGGGTCCTTATTCTCGAGAATAAGGACCCTTCATCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-771s1c1
Sequence:CCGGCTAGAGATGAAGGGTCCTTATCTCGAGATAAGGACCCTTCATCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153521.1-2451s1c1
Sequence:CCGGCTGATTCTGTCATCCTCTTTCCTCGAGGAAAGAGGATGACAGAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-892s21c1
Sequence:CCGGTGTACCTCCCACTCGTGTAACCTCGAGGTTACACGAGTGGGAGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153521
LRRC41 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 41
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-1585s1c1
Sequence:CCGGCCTGTCTATTCGTGTTGACCACTCGAGTGGTCAACACGAATAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-373s1c1
Sequence:CCGGGTCTTCTGATAAACGTCTTTGCTCGAGCAAAGACGTTTATCAGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153521.1-2469s21c1
Sequence:CCGGTTCTGCCACTTTGTCTATTTCCTCGAGGAAATAGACAAAGTGGCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-830s21c1
Sequence:CCGGCGATGTGCTGCTGCACTAATGCTCGAGCATTAGTGCAGCAGCACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-170s21c1
Sequence:CCGGATCTTACCTCTGCTCAATATACTCGAGTATATTGAGCAGAGGTAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-772s21c1
Sequence:CCGGTAGAGATGAAGGGTCCTTATTCTCGAGAATAAGGACCCTTCATCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-771s1c1
Sequence:CCGGCTAGAGATGAAGGGTCCTTATCTCGAGATAAGGACCCTTCATCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153521.1-2451s1c1
Sequence:CCGGCTGATTCTGTCATCCTCTTTCCTCGAGGAAAGAGGATGACAGAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-892s21c1
Sequence:CCGGTGTACCTCCCACTCGTGTAACCTCGAGGTTACACGAGTGGGAGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153521
LRRC41 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 41
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-1585s1c1
Sequence:CCGGCCTGTCTATTCGTGTTGACCACTCGAGTGGTCAACACGAATAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-373s1c1
Sequence:CCGGGTCTTCTGATAAACGTCTTTGCTCGAGCAAAGACGTTTATCAGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153521.1-2469s21c1
Sequence:CCGGTTCTGCCACTTTGTCTATTTCCTCGAGGAAATAGACAAAGTGGCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-830s21c1
Sequence:CCGGCGATGTGCTGCTGCACTAATGCTCGAGCATTAGTGCAGCAGCACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-170s21c1
Sequence:CCGGATCTTACCTCTGCTCAATATACTCGAGTATATTGAGCAGAGGTAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-772s21c1
Sequence:CCGGTAGAGATGAAGGGTCCTTATTCTCGAGAATAAGGACCCTTCATCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153521.1-771s1c1
Sequence:CCGGCTAGAGATGAAGGGTCCTTATCTCGAGATAAGGACCCTTCATCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153521.1-2451s1c1
Sequence:CCGGCTGATTCTGTCATCCTCTTTCCTCGAGGAAAGAGGATGACAGAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153521.1-892s21c1
Sequence:CCGGTGTACCTCCCACTCGTGTAACCTCGAGGTTACACGAGTGGGAGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)