EMAIL THIS PAGE TO A FRIEND

LRRC42

leucine rich repeat containing 42

67 Gene Product Result for
Synonyms: dJ167A19.4
UniProtKB ID: Q9Y546, D3DQ46, Q8N2Q8
Gene ID:
Mouse(77809) leucine rich repeat containing 42
Rat(298309) leucine rich repeat containing 42
Zebrafish(326793) leucine rich repeat containing 42
cow(534728) leucine rich repeat containing 42
Horse(100060662) leucine rich repeat containing 42
domestic cat(101095759) leucine rich repeat containing 42
chicken(424655) leucine rich repeat containing 42
dog(489580) leucine rich repeat containing 42
sheep(101120708) leucine rich repeat containing 42
Domestic Rabbit(100353359) leucine rich repeat containing 42
naked mole-rat(101704246) leucine rich repeat containing 42
domestic guinea pig(100715107) leucine rich repeat containing 42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052940 Rosetta Predictions human pricing
NM_001025653 Rosetta Predictions rat pricing
NM_029985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126835 predicted 1277
2 SASI_Hs01_00126836 predicted 1462
3 SASI_Hs01_00126837 predicted 197
4 SASI_Hs01_00126838 predicted 1261
5 SASI_Hs01_00126839 predicted 1071
6 SASI_Hs01_00126840 predicted 1424
7 SASI_Hs01_00126841 predicted 779
8 SASI_Hs02_00361726 predicted 454
9 SASI_Hs01_00126844 predicted 927
10 SASI_Hs02_00361727 predicted 1396
11 SASI_Hs01_00126842 predicted 618
12 SASI_Hs01_00126843 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203228 predicted 746
2 SASI_Rn01_00105653 predicted 1022
3 SASI_Rn01_00105654 predicted 887
4 SASI_Rn01_00105655 predicted 785
5 SASI_Rn01_00105656 predicted 519
6 SASI_Rn01_00105657 predicted 930
7 SASI_Rn01_00105659 predicted 1305
8 SASI_Rn01_00105660 predicted 1382
9 SASI_Rn01_00105661 predicted 602
10 SASI_Rn01_00105662 predicted 611
11 SASI_Rn01_00105658 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095599 predicted 979
2 SASI_Mm01_00095600 predicted 852
3 SASI_Mm01_00095602 predicted 998
4 SASI_Mm01_00095603 predicted 1109
5 SASI_Mm01_00095604 predicted 566
6 SASI_Mm01_00095606 predicted 1395
7 SASI_Mm01_00095607 predicted 1282
8 SASI_Mm01_00095608 predicted 1145
9 SASI_Mm02_00336327 predicted 998
10 SASI_Mm02_00336328 predicted 1144
11 SASI_Mm01_00095601 predicted 273
12 SASI_Mm01_00095605 predicted 1521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029985
VALIDATED
LRRC42 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 42
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-1301s21c1
Sequence:CCGGGCACAGAAGTTACAAGGAAATCTCGAGATTTCCTTGTAACTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-884s1c1
Sequence:CCGGCGCTGTTAGACCTGTCTTGTACTCGAGTACAAGACAGGTCTAACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-980s21c1
Sequence:CCGGCGCTGTTAGACCTGTCTTGTACTCGAGTACAAGACAGGTCTAACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-1273s21c1
Sequence:CCGGGCTCAATACTTCTACCAGAATCTCGAGATTCTGGTAGAAGTATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1205s1c1
Sequence:CCGGGCACAGAAGTTACAAGGAAATCTCGAGATTTCCTTGTAACTTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1177s1c1
Sequence:CCGGGCTCAATACTTCTACCAGAATCTCGAGATTCTGGTAGAAGTATTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1528s1c1
Sequence:CCGGGCATTAGCATAGCAAGCAGATCTCGAGATCTGCTTGCTATGCTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029985.2-1624s21c1
Sequence:CCGGGCATTAGCATAGCAAGCAGATCTCGAGATCTGCTTGCTATGCTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029985
VALIDATED
LRRC42 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 42
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-1301s21c1
Sequence:CCGGGCACAGAAGTTACAAGGAAATCTCGAGATTTCCTTGTAACTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-884s1c1
Sequence:CCGGCGCTGTTAGACCTGTCTTGTACTCGAGTACAAGACAGGTCTAACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-980s21c1
Sequence:CCGGCGCTGTTAGACCTGTCTTGTACTCGAGTACAAGACAGGTCTAACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-1273s21c1
Sequence:CCGGGCTCAATACTTCTACCAGAATCTCGAGATTCTGGTAGAAGTATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1205s1c1
Sequence:CCGGGCACAGAAGTTACAAGGAAATCTCGAGATTTCCTTGTAACTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1177s1c1
Sequence:CCGGGCTCAATACTTCTACCAGAATCTCGAGATTCTGGTAGAAGTATTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1528s1c1
Sequence:CCGGGCATTAGCATAGCAAGCAGATCTCGAGATCTGCTTGCTATGCTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029985.2-1624s21c1
Sequence:CCGGGCATTAGCATAGCAAGCAGATCTCGAGATCTGCTTGCTATGCTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029985
VALIDATED
LRRC42 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 42
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-1301s21c1
Sequence:CCGGGCACAGAAGTTACAAGGAAATCTCGAGATTTCCTTGTAACTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-884s1c1
Sequence:CCGGCGCTGTTAGACCTGTCTTGTACTCGAGTACAAGACAGGTCTAACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-980s21c1
Sequence:CCGGCGCTGTTAGACCTGTCTTGTACTCGAGTACAAGACAGGTCTAACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029985.2-1273s21c1
Sequence:CCGGGCTCAATACTTCTACCAGAATCTCGAGATTCTGGTAGAAGTATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1205s1c1
Sequence:CCGGGCACAGAAGTTACAAGGAAATCTCGAGATTTCCTTGTAACTTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1177s1c1
Sequence:CCGGGCTCAATACTTCTACCAGAATCTCGAGATTCTGGTAGAAGTATTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029985.1-1528s1c1
Sequence:CCGGGCATTAGCATAGCAAGCAGATCTCGAGATCTGCTTGCTATGCTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029985.2-1624s21c1
Sequence:CCGGGCATTAGCATAGCAAGCAGATCTCGAGATCTGCTTGCTATGCTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052940
LRRC42 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 42
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052940.3-1541s21c1
Sequence:CCGGAGGAGACTGAGGATGATTTACCTCGAGGTAAATCATCCTCAGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052940.3-695s1c1
Sequence:CCGGGCTTGAGGAGATTAAGTCTTTCTCGAGAAAGACTTAATCTCCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052940.3-892s1c1
Sequence:CCGGGCCTTGAGAATCTAACATTATCTCGAGATAATGTTAGATTCTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-442s21c1
Sequence:CCGGATCTTCGGTACTCCGCCAAATCTCGAGATTTGGCGGAGTACCGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-395s21c1
Sequence:CCGGGAAAGAGAAGACTGATCATTTCTCGAGAAATGATCAGTCTTCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-891s21c1
Sequence:CCGGGGCCTTGAGAATCTAACATTACTCGAGTAATGTTAGATTCTCAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-667s21c1
Sequence:CCGGGAAACAGGTATCTCGTGATTTCTCGAGAAATCACGAGATACCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052940
LRRC42 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 42
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052940.3-1541s21c1
Sequence:CCGGAGGAGACTGAGGATGATTTACCTCGAGGTAAATCATCCTCAGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052940.3-695s1c1
Sequence:CCGGGCTTGAGGAGATTAAGTCTTTCTCGAGAAAGACTTAATCTCCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052940.3-892s1c1
Sequence:CCGGGCCTTGAGAATCTAACATTATCTCGAGATAATGTTAGATTCTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-442s21c1
Sequence:CCGGATCTTCGGTACTCCGCCAAATCTCGAGATTTGGCGGAGTACCGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-395s21c1
Sequence:CCGGGAAAGAGAAGACTGATCATTTCTCGAGAAATGATCAGTCTTCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-891s21c1
Sequence:CCGGGGCCTTGAGAATCTAACATTACTCGAGTAATGTTAGATTCTCAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-667s21c1
Sequence:CCGGGAAACAGGTATCTCGTGATTTCTCGAGAAATCACGAGATACCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052940
LRRC42 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 42
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052940.3-1541s21c1
Sequence:CCGGAGGAGACTGAGGATGATTTACCTCGAGGTAAATCATCCTCAGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052940.3-695s1c1
Sequence:CCGGGCTTGAGGAGATTAAGTCTTTCTCGAGAAAGACTTAATCTCCTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052940.3-892s1c1
Sequence:CCGGGCCTTGAGAATCTAACATTATCTCGAGATAATGTTAGATTCTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-442s21c1
Sequence:CCGGATCTTCGGTACTCCGCCAAATCTCGAGATTTGGCGGAGTACCGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-395s21c1
Sequence:CCGGGAAAGAGAAGACTGATCATTTCTCGAGAAATGATCAGTCTTCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-891s21c1
Sequence:CCGGGGCCTTGAGAATCTAACATTACTCGAGTAATGTTAGATTCTCAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052940.3-667s21c1
Sequence:CCGGGAAACAGGTATCTCGTGATTTCTCGAGAAATCACGAGATACCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)