EMAIL THIS PAGE TO A FRIEND

LRRC43

leucine rich repeat containing 43

73 Gene Product Result for
UniProtKB ID: Q8N309, Q6ZVT9
Gene ID:
Mouse(381741) leucine rich repeat containing 43
Rat(288751) leucine rich repeat containing 43
domestic guinea pig(100713801) leucine rich repeat containing 43
naked mole-rat(101707796) leucine rich repeat containing 43
sheep(101102515) leucine rich repeat containing 43
chicken(416859) leucine rich repeat containing 43
domestic cat(101095200) leucine rich repeat containing 43
Horse(100060035) leucine rich repeat containing 43
cow(784978) leucine rich repeat containing 43
dog(100682581) leucine rich repeat containing 43
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152759 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098519 Rosetta Predictions human pricing
NM_152759 Rosetta Predictions human pricing
XM_001079292 Rosetta Predictions rat pricing
XM_213813 Rosetta Predictions rat pricing
NM_001033461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319247 predicted 1320
2 SASI_Hs02_00319248 predicted 1245
3 SASI_Hs02_00319249 predicted 710
4 SASI_Hs02_00319250 predicted 383
5 SASI_Hs02_00319251 predicted 860
6 SASI_Hs02_00319252 predicted 562
7 SASI_Hs02_00319253 predicted 993
8 SASI_Hs02_00319254 predicted 873
9 SASI_Hs02_00319255 predicted 1033
10 SASI_Hs02_00319256 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220792 predicted 1215
2 SASI_Hs01_00220795 predicted 1141
3 SASI_Hs02_00366691 predicted 750
4 SASI_Hs02_00366692 predicted 545
5 SASI_Hs02_00366693 predicted 875
6 SASI_Hs01_00220797 predicted 766
7 SASI_Hs01_00220798 predicted 921
8 SASI_Hs01_00220800 predicted 952
9 SASI_Hs02_00366694 predicted 556
10 SASI_Hs02_00366695 predicted 1020
11 SASI_Hs01_00220793 predicted 861
12 SASI_Hs01_00220794 predicted 1457
13 SASI_Hs01_00220796 predicted 1183
14 SASI_Hs01_00220799 predicted 1216
15 SASI_Hs01_00220801 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363830 predicted 1579
2 SASI_Rn02_00363831 predicted 340
3 SASI_Rn02_00363832 predicted 410
4 SASI_Rn02_00363833 predicted 435
5 SASI_Rn02_00363834 predicted 472
6 SASI_Rn02_00363835 predicted 330
7 SASI_Rn02_00363836 predicted 537
8 SASI_Rn02_00363837 predicted 1409
9 SASI_Rn02_00363838 predicted 339
10 SASI_Rn02_00363839 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374936 predicted 446
2 SASI_Rn02_00374937 predicted 297
3 SASI_Rn02_00374938 predicted 347
4 SASI_Rn02_00374939 predicted 348
5 SASI_Rn02_00374940 predicted 408
6 SASI_Rn02_00374941 predicted 441
7 SASI_Rn02_00374942 predicted 332
8 SASI_Rn02_00374943 predicted 265
9 SASI_Rn02_00374944 predicted 402
10 SASI_Rn02_00374945 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156844 predicted 1651
2 SASI_Mm01_00156845 predicted 1065
3 SASI_Mm02_00288800 predicted 357
4 SASI_Mm02_00288801 predicted 1010
5 SASI_Mm01_00156847 predicted 1081
6 SASI_Mm01_00156849 predicted 1278
7 SASI_Mm01_00156850 predicted 333
8 SASI_Mm01_00156851 predicted 806
9 SASI_Mm01_00156852 predicted 954
10 SASI_Mm01_00156853 predicted 1346
11 SASI_Mm01_00156846 predicted 1119
12 SASI_Mm01_00156848 predicted 1780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152759
LRRC43 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 43
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-1217s21c1
Sequence:CCGGGCCAAGTTGAGGCTGCGTATACTCGAGTATACGCAGCCTCAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-931s21c1
Sequence:CCGGCTATTACGTGACCTATGATTTCTCGAGAAATCATAGGTCACGTAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-551s21c1
Sequence:CCGGAGTCTCTACGTCACCGCTAATCTCGAGATTAGCGGTGACGTAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-1712s21c1
Sequence:CCGGACGTTGGCCAGGGATTCAAAGCTCGAGCTTTGAATCCCTGGCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-955s21c1
Sequence:CCGGGAAAGATGAAGAAGGCGAAATCTCGAGATTTCGCCTTCTTCATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152759.3-1447s1c1
Sequence:CCGGGACGTCATCGAAGACATTGTTCTCGAGAACAATGTCTTCGATGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152759.3-862s1c1
Sequence:CCGGCTGAGATCAATTTGCTTTCTACTCGAGTAGAAAGCAAATTGATCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152759
LRRC43 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 43
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-1217s21c1
Sequence:CCGGGCCAAGTTGAGGCTGCGTATACTCGAGTATACGCAGCCTCAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-931s21c1
Sequence:CCGGCTATTACGTGACCTATGATTTCTCGAGAAATCATAGGTCACGTAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-551s21c1
Sequence:CCGGAGTCTCTACGTCACCGCTAATCTCGAGATTAGCGGTGACGTAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-1712s21c1
Sequence:CCGGACGTTGGCCAGGGATTCAAAGCTCGAGCTTTGAATCCCTGGCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-955s21c1
Sequence:CCGGGAAAGATGAAGAAGGCGAAATCTCGAGATTTCGCCTTCTTCATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152759.3-1447s1c1
Sequence:CCGGGACGTCATCGAAGACATTGTTCTCGAGAACAATGTCTTCGATGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152759.3-862s1c1
Sequence:CCGGCTGAGATCAATTTGCTTTCTACTCGAGTAGAAAGCAAATTGATCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152759
LRRC43 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 43
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-1217s21c1
Sequence:CCGGGCCAAGTTGAGGCTGCGTATACTCGAGTATACGCAGCCTCAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-931s21c1
Sequence:CCGGCTATTACGTGACCTATGATTTCTCGAGAAATCATAGGTCACGTAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-551s21c1
Sequence:CCGGAGTCTCTACGTCACCGCTAATCTCGAGATTAGCGGTGACGTAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-1712s21c1
Sequence:CCGGACGTTGGCCAGGGATTCAAAGCTCGAGCTTTGAATCCCTGGCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152759.4-955s21c1
Sequence:CCGGGAAAGATGAAGAAGGCGAAATCTCGAGATTTCGCCTTCTTCATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152759.3-1447s1c1
Sequence:CCGGGACGTCATCGAAGACATTGTTCTCGAGAACAATGTCTTCGATGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152759.3-862s1c1
Sequence:CCGGCTGAGATCAATTTGCTTTCTACTCGAGTAGAAAGCAAATTGATCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033461
LRRC43 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 43
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-340s21c1
Sequence:CCGGAGAATCCACTGATGATCAAAGCTCGAGCTTTGATCATCAGTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1451s21c1
Sequence:CCGGCAAGCCCTGGTCAGATGTTATCTCGAGATAACATCTGACCAGGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1002s21c1
Sequence:CCGGTTCATTAGCTACAGCTATTATCTCGAGATAATAGCTGTAGCTAATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1309s21c1
Sequence:CCGGACTGGTCGGAGACGAGCATTTCTCGAGAAATGCTCGTCTCCGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1836s21c1
Sequence:CCGGACACATGCCAGGGATTCAAAGCTCGAGCTTTGAATCCCTGGCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033461
LRRC43 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 43
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-340s21c1
Sequence:CCGGAGAATCCACTGATGATCAAAGCTCGAGCTTTGATCATCAGTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1451s21c1
Sequence:CCGGCAAGCCCTGGTCAGATGTTATCTCGAGATAACATCTGACCAGGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1002s21c1
Sequence:CCGGTTCATTAGCTACAGCTATTATCTCGAGATAATAGCTGTAGCTAATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1309s21c1
Sequence:CCGGACTGGTCGGAGACGAGCATTTCTCGAGAAATGCTCGTCTCCGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1836s21c1
Sequence:CCGGACACATGCCAGGGATTCAAAGCTCGAGCTTTGAATCCCTGGCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033461
LRRC43 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 43
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-340s21c1
Sequence:CCGGAGAATCCACTGATGATCAAAGCTCGAGCTTTGATCATCAGTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1451s21c1
Sequence:CCGGCAAGCCCTGGTCAGATGTTATCTCGAGATAACATCTGACCAGGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1002s21c1
Sequence:CCGGTTCATTAGCTACAGCTATTATCTCGAGATAATAGCTGTAGCTAATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1309s21c1
Sequence:CCGGACTGGTCGGAGACGAGCATTTCTCGAGAAATGCTCGTCTCCGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033461.2-1836s21c1
Sequence:CCGGACACATGCCAGGGATTCAAAGCTCGAGCTTTGAATCCCTGGCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)