EMAIL THIS PAGE TO A FRIEND

LRRC45

leucine rich repeat containing 45

47 Gene Product Result for
UniProtKB ID: Q96CN5
Gene ID:
Mouse(217366) leucine rich repeat containing 45
Rat(688318) leucine rich repeat containing 45
chicken(770573) leucine rich repeat containing 45
cow(514524) leucine rich repeat containing 45
Horse(100049808) leucine rich repeat containing 45
domestic cat(101101680) leucine rich repeat containing 45
dog(483375) leucine rich repeat containing 45
sheep(101112659) leucine rich repeat containing 45
naked mole-rat(101723186) leucine rich repeat containing 45
domestic guinea pig(100735895) leucine rich repeat containing 45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144999 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144999 Rosetta Predictions human pricing
NM_001127571 Rosetta Predictions rat pricing
NM_153545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034289 predicted 1013
2 SASI_Hs01_00034290 predicted 995
3 SASI_Hs01_00034291 predicted 352
4 SASI_Hs01_00034293 predicted 1517
5 SASI_Hs01_00034294 predicted 933
6 SASI_Hs01_00034295 predicted 1289
7 SASI_Hs01_00034296 predicted 1033
8 SASI_Hs01_00034297 predicted 1105
9 SASI_Hs01_00034298 predicted 1576
10 SASI_Hs02_00364833 predicted 573
11 SASI_Hs01_00034292 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254463 predicted 820
2 SASI_Rn02_00254464 predicted 913
3 SASI_Rn02_00254465 predicted 1011
4 SASI_Rn02_00254466 predicted 855
5 SASI_Rn02_00254467 predicted 468
6 SASI_Rn02_00254468 predicted 590
7 SASI_Rn02_00254469 predicted 1408
8 SASI_Rn02_00254470 predicted 2035
9 SASI_Rn02_00254471 predicted 948
10 SASI_Rn02_00254472 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086511 predicted 829
2 SASI_Mm01_00086512 predicted 562
3 SASI_Mm01_00086513 predicted 1831
4 SASI_Mm01_00086514 predicted 894
5 SASI_Mm01_00086515 predicted 1007
6 SASI_Mm01_00086516 predicted 428
7 SASI_Mm01_00086517 predicted 2157
8 SASI_Mm01_00086518 predicted 742
9 SASI_Mm01_00086519 predicted 2005
10 SASI_Mm02_00343313 predicted 938
11 SASI_Mm01_00086520 predicted 923
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144999
LRRC45 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 45
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1017s1c1
Sequence:CCGGCCTCGACTTGATGGAGACTATCTCGAGATAGTCTCCATCAAGTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1437s1c1
Sequence:CCGGCATGTCAGCTGAGCTGAAGATCTCGAGATCTTCAGCTCAGCTGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1008s1c1
Sequence:CCGGCAAGCAGTTCCTCGACTTGATCTCGAGATCAAGTCGAGGAACTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-696s1c1
Sequence:CCGGCAACAACCAGATCAGTCACAACTCGAGTTGTGACTGATCTGGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-514s1c1
Sequence:CCGGGACTTAAAGGGCAACAACCTTCTCGAGAAGGTTGTTGCCCTTTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1021s1c1
Sequence:CCGGGACTTGATGGAGACTATTGATCTCGAGATCAATAGTCTCCATCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1026s1c1
Sequence:CCGGGATGGAGACTATTGATAAGCACTCGAGTGCTTATCAATAGTCTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1023s1c1
Sequence:CCGGCTTGATGGAGACTATTGATAACTCGAGTTATCAATAGTCTCCATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-501s1c1
Sequence:CCGGGCTGCGCTTTCTGGACTTAAACTCGAGTTTAAGTCCAGAAAGCGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144999
LRRC45 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 45
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1017s1c1
Sequence:CCGGCCTCGACTTGATGGAGACTATCTCGAGATAGTCTCCATCAAGTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1437s1c1
Sequence:CCGGCATGTCAGCTGAGCTGAAGATCTCGAGATCTTCAGCTCAGCTGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1008s1c1
Sequence:CCGGCAAGCAGTTCCTCGACTTGATCTCGAGATCAAGTCGAGGAACTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-696s1c1
Sequence:CCGGCAACAACCAGATCAGTCACAACTCGAGTTGTGACTGATCTGGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-514s1c1
Sequence:CCGGGACTTAAAGGGCAACAACCTTCTCGAGAAGGTTGTTGCCCTTTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1021s1c1
Sequence:CCGGGACTTGATGGAGACTATTGATCTCGAGATCAATAGTCTCCATCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1026s1c1
Sequence:CCGGGATGGAGACTATTGATAAGCACTCGAGTGCTTATCAATAGTCTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1023s1c1
Sequence:CCGGCTTGATGGAGACTATTGATAACTCGAGTTATCAATAGTCTCCATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-501s1c1
Sequence:CCGGGCTGCGCTTTCTGGACTTAAACTCGAGTTTAAGTCCAGAAAGCGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144999
LRRC45 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 45
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1017s1c1
Sequence:CCGGCCTCGACTTGATGGAGACTATCTCGAGATAGTCTCCATCAAGTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1437s1c1
Sequence:CCGGCATGTCAGCTGAGCTGAAGATCTCGAGATCTTCAGCTCAGCTGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1008s1c1
Sequence:CCGGCAAGCAGTTCCTCGACTTGATCTCGAGATCAAGTCGAGGAACTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-696s1c1
Sequence:CCGGCAACAACCAGATCAGTCACAACTCGAGTTGTGACTGATCTGGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-514s1c1
Sequence:CCGGGACTTAAAGGGCAACAACCTTCTCGAGAAGGTTGTTGCCCTTTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1021s1c1
Sequence:CCGGGACTTGATGGAGACTATTGATCTCGAGATCAATAGTCTCCATCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1026s1c1
Sequence:CCGGGATGGAGACTATTGATAAGCACTCGAGTGCTTATCAATAGTCTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-1023s1c1
Sequence:CCGGCTTGATGGAGACTATTGATAACTCGAGTTATCAATAGTCTCCATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144999.2-501s1c1
Sequence:CCGGGCTGCGCTTTCTGGACTTAAACTCGAGTTTAAGTCCAGAAAGCGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153545
LRRC45 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 45
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153545.1-1789s1c1
Sequence:CCGGCTGATCAACAAAGACCAAGAACTCGAGTTCTTGGTCTTTGTTGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153545.1-2290s1c1
Sequence:CCGGCCACAGTTCACCGTTAGCATACTCGAGTATGCTAACGGTGAACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153545.1-2277s1c1
Sequence:CCGGCAAGGGACTTCATCCACAGTTCTCGAGAACTGTGGATGAAGTCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-379s21c1
Sequence:CCGGGTGCAGCATCTGGATCTAAAGCTCGAGCTTTAGATCCAGATGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-1416s21c1
Sequence:CCGGCTCCAAGGAGGTGGATCATATCTCGAGATATGATCCACCTCCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153545.1-2286s21c1
Sequence:CCGGTCATCCACAGTTCACCGTTAGCTCGAGCTAACGGTGAACTGTGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-1172s21c1
Sequence:CCGGCAGATCGGGAGTCCAAGTTACCTCGAGGTAACTTGGACTCCCGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-445s21c1
Sequence:CCGGCTTCGACAGAACAAGTCTATTCTCGAGAATAGACTTGTTCTGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153545
LRRC45 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 45
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153545.1-1789s1c1
Sequence:CCGGCTGATCAACAAAGACCAAGAACTCGAGTTCTTGGTCTTTGTTGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153545.1-2290s1c1
Sequence:CCGGCCACAGTTCACCGTTAGCATACTCGAGTATGCTAACGGTGAACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153545.1-2277s1c1
Sequence:CCGGCAAGGGACTTCATCCACAGTTCTCGAGAACTGTGGATGAAGTCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-379s21c1
Sequence:CCGGGTGCAGCATCTGGATCTAAAGCTCGAGCTTTAGATCCAGATGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-1416s21c1
Sequence:CCGGCTCCAAGGAGGTGGATCATATCTCGAGATATGATCCACCTCCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153545.1-2286s21c1
Sequence:CCGGTCATCCACAGTTCACCGTTAGCTCGAGCTAACGGTGAACTGTGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-1172s21c1
Sequence:CCGGCAGATCGGGAGTCCAAGTTACCTCGAGGTAACTTGGACTCCCGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-445s21c1
Sequence:CCGGCTTCGACAGAACAAGTCTATTCTCGAGAATAGACTTGTTCTGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153545
LRRC45 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 45
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153545.1-1789s1c1
Sequence:CCGGCTGATCAACAAAGACCAAGAACTCGAGTTCTTGGTCTTTGTTGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153545.1-2290s1c1
Sequence:CCGGCCACAGTTCACCGTTAGCATACTCGAGTATGCTAACGGTGAACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153545.1-2277s1c1
Sequence:CCGGCAAGGGACTTCATCCACAGTTCTCGAGAACTGTGGATGAAGTCCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-379s21c1
Sequence:CCGGGTGCAGCATCTGGATCTAAAGCTCGAGCTTTAGATCCAGATGCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-1416s21c1
Sequence:CCGGCTCCAAGGAGGTGGATCATATCTCGAGATATGATCCACCTCCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153545.1-2286s21c1
Sequence:CCGGTCATCCACAGTTCACCGTTAGCTCGAGCTAACGGTGAACTGTGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-1172s21c1
Sequence:CCGGCAGATCGGGAGTCCAAGTTACCTCGAGGTAACTTGGACTCCCGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153545.1-445s21c1
Sequence:CCGGCTTCGACAGAACAAGTCTATTCTCGAGAATAGACTTGTTCTGTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)