EMAIL THIS PAGE TO A FRIEND

LRRC47

leucine rich repeat containing 47

54 Gene Product Result for
UniProtKB ID: Q8N1G4, Q9ULN5
Gene ID:
Mouse(72946) leucine rich repeat containing 47
Rat(362672) leucine rich repeat containing 47
Zebrafish(553404) leucine rich repeat containing 47
chicken(419380) leucine rich repeat containing 47
dog(489622) leucine rich repeat containing 47
domestic cat(101088594) leucine rich repeat containing 47
Horse(100146297) leucine rich repeat containing 47
cow(616209) leucine rich repeat containing 47
sheep(101118464) leucine rich repeat containing 47
naked mole-rat(101715326) leucine rich repeat containing 47
domestic guinea pig(100727682) leucine rich repeat containing 47
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023191 MISSION® esiRNA esiRNA human LRRC47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020710 Rosetta Predictions human pricing
XM_001076460 Rosetta Predictions rat pricing
XM_342990 Rosetta Predictions rat pricing
NM_201226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246851 predicted 1592
2 SASI_Hs01_00246852 predicted 1418
3 SASI_Hs01_00246853 predicted 580
4 SASI_Hs01_00246854 predicted 1203
5 SASI_Hs01_00246855 predicted 1478
6 SASI_Hs01_00246856 predicted 1414
7 SASI_Hs01_00246857 predicted 1418
8 SASI_Hs01_00246858 predicted 1377
9 SASI_Hs01_00246859 predicted 497
10 SASI_Hs01_00246860 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353312 predicted 707
2 SASI_Rn02_00353313 predicted 770
3 SASI_Rn02_00353314 predicted 1602
4 SASI_Rn02_00353315 predicted 650
5 SASI_Rn02_00353316 predicted 1414
6 SASI_Rn02_00353317 predicted 1379
7 SASI_Rn02_00353318 predicted 1389
8 SASI_Rn02_00353319 predicted 1406
9 SASI_Rn02_00353320 predicted 1392
10 SASI_Rn02_00353321 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395161 predicted 916
2 SASI_Rn02_00395162 predicted 763
3 SASI_Rn02_00395163 predicted 754
4 SASI_Rn02_00395164 predicted 934
5 SASI_Rn02_00395165 predicted 1061
6 SASI_Rn02_00395166 predicted 1183
7 SASI_Rn02_00395167 predicted 1129
8 SASI_Rn02_00395168 predicted 1121
9 SASI_Rn02_00395169 predicted 1046
10 SASI_Rn02_00395170 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182127 predicted 1432
2 SASI_Mm01_00182129 predicted 1482
3 SASI_Mm01_00182130 predicted 1060
4 SASI_Mm01_00182131 predicted 640
5 SASI_Mm01_00182132 predicted 1457
6 SASI_Mm02_00351482 predicted 1379
7 SASI_Mm01_00182133 predicted 972
8 SASI_Mm01_00182134 predicted 1295
9 SASI_Mm01_00182135 predicted 639
10 SASI_Mm01_00182136 predicted 633
11 SASI_Mm01_00182128 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020710
VALIDATED
LRRC47 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 47
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1342s1c1
Sequence:CCGGCCTTCACTTGCTGGATGGAAACTCGAGTTTCCATCCAGCAAGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-715s1c1
Sequence:CCGGGATCAATTTCCGTGGGAACAACTCGAGTTGTTCCCACGGAAATTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1495s1c1
Sequence:CCGGGCAGATTTGCAAGGATGTCATCTCGAGATGACATCCTTGCAAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020710.1-1400s1c1
Sequence:CCGGGTGATTTCCTTCCCACCAATACTCGAGTATTGGTGGGAAGGAAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1836s1c1
Sequence:CCGGGCAATGCTGAATTATCCGTTACTCGAGTAACGGATAATTCAGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020710.1-1411s1c1
Sequence:CCGGCCCACCAATAACCAACAGTGACTCGAGTCACTGTTGGTTATTGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-701s1c1
Sequence:CCGGCCCAAGCTCAAGGAGATCAATCTCGAGATTGATCTCCTTGAGCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1571s1c1
Sequence:CCGGGAGGAAGGATCACTCTCAGATCTCGAGATCTGAGAGTGATCCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-2021s1c1
Sequence:CCGGGTGCCACTAAGCTCAGCTAATCTCGAGATTAGCTGAGCTTAGTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1601s1c1
Sequence:CCGGGATGCAGTCTCTGGACAACTTCTCGAGAAGTTGTCCAGAGACTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1114s1c1
Sequence:CCGGCCACGAAGATCTCTGTGAGAACTCGAGTTCTCACAGAGATCTTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1619s1c1
Sequence:CCGGCTTCCAGATCCCACAACGAATCTCGAGATTCGTTGTGGGATCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020710.2-1836s21c1
Sequence:CCGGGCAATGCTGAATTATCCGTTACTCGAGTAACGGATAATTCAGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-715s21c1
Sequence:CCGGGATCAATTTCCGTGGGAACAACTCGAGTTGTTCCCACGGAAATTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-701s21c1
Sequence:CCGGCCCAAGCTCAAGGAGATCAATCTCGAGATTGATCTCCTTGAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-1342s21c1
Sequence:CCGGCCTTCACTTGCTGGATGGAAACTCGAGTTTCCATCCAGCAAGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-1619s21c1
Sequence:CCGGCTTCCAGATCCCACAACGAATCTCGAGATTCGTTGTGGGATCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020710
VALIDATED
LRRC47 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 47
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1342s1c1
Sequence:CCGGCCTTCACTTGCTGGATGGAAACTCGAGTTTCCATCCAGCAAGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-715s1c1
Sequence:CCGGGATCAATTTCCGTGGGAACAACTCGAGTTGTTCCCACGGAAATTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1495s1c1
Sequence:CCGGGCAGATTTGCAAGGATGTCATCTCGAGATGACATCCTTGCAAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020710.1-1400s1c1
Sequence:CCGGGTGATTTCCTTCCCACCAATACTCGAGTATTGGTGGGAAGGAAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1836s1c1
Sequence:CCGGGCAATGCTGAATTATCCGTTACTCGAGTAACGGATAATTCAGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020710.1-1411s1c1
Sequence:CCGGCCCACCAATAACCAACAGTGACTCGAGTCACTGTTGGTTATTGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-701s1c1
Sequence:CCGGCCCAAGCTCAAGGAGATCAATCTCGAGATTGATCTCCTTGAGCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1571s1c1
Sequence:CCGGGAGGAAGGATCACTCTCAGATCTCGAGATCTGAGAGTGATCCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-2021s1c1
Sequence:CCGGGTGCCACTAAGCTCAGCTAATCTCGAGATTAGCTGAGCTTAGTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1601s1c1
Sequence:CCGGGATGCAGTCTCTGGACAACTTCTCGAGAAGTTGTCCAGAGACTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1114s1c1
Sequence:CCGGCCACGAAGATCTCTGTGAGAACTCGAGTTCTCACAGAGATCTTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1619s1c1
Sequence:CCGGCTTCCAGATCCCACAACGAATCTCGAGATTCGTTGTGGGATCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020710.2-1836s21c1
Sequence:CCGGGCAATGCTGAATTATCCGTTACTCGAGTAACGGATAATTCAGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-715s21c1
Sequence:CCGGGATCAATTTCCGTGGGAACAACTCGAGTTGTTCCCACGGAAATTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-701s21c1
Sequence:CCGGCCCAAGCTCAAGGAGATCAATCTCGAGATTGATCTCCTTGAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-1342s21c1
Sequence:CCGGCCTTCACTTGCTGGATGGAAACTCGAGTTTCCATCCAGCAAGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-1619s21c1
Sequence:CCGGCTTCCAGATCCCACAACGAATCTCGAGATTCGTTGTGGGATCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020710
VALIDATED
LRRC47 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 47
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1342s1c1
Sequence:CCGGCCTTCACTTGCTGGATGGAAACTCGAGTTTCCATCCAGCAAGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-715s1c1
Sequence:CCGGGATCAATTTCCGTGGGAACAACTCGAGTTGTTCCCACGGAAATTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1495s1c1
Sequence:CCGGGCAGATTTGCAAGGATGTCATCTCGAGATGACATCCTTGCAAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020710.1-1400s1c1
Sequence:CCGGGTGATTTCCTTCCCACCAATACTCGAGTATTGGTGGGAAGGAAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1836s1c1
Sequence:CCGGGCAATGCTGAATTATCCGTTACTCGAGTAACGGATAATTCAGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020710.1-1411s1c1
Sequence:CCGGCCCACCAATAACCAACAGTGACTCGAGTCACTGTTGGTTATTGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-701s1c1
Sequence:CCGGCCCAAGCTCAAGGAGATCAATCTCGAGATTGATCTCCTTGAGCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1571s1c1
Sequence:CCGGGAGGAAGGATCACTCTCAGATCTCGAGATCTGAGAGTGATCCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-2021s1c1
Sequence:CCGGGTGCCACTAAGCTCAGCTAATCTCGAGATTAGCTGAGCTTAGTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020710.1-1601s1c1
Sequence:CCGGGATGCAGTCTCTGGACAACTTCTCGAGAAGTTGTCCAGAGACTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1114s1c1
Sequence:CCGGCCACGAAGATCTCTGTGAGAACTCGAGTTCTCACAGAGATCTTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020710.1-1619s1c1
Sequence:CCGGCTTCCAGATCCCACAACGAATCTCGAGATTCGTTGTGGGATCTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020710.2-1836s21c1
Sequence:CCGGGCAATGCTGAATTATCCGTTACTCGAGTAACGGATAATTCAGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-715s21c1
Sequence:CCGGGATCAATTTCCGTGGGAACAACTCGAGTTGTTCCCACGGAAATTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-701s21c1
Sequence:CCGGCCCAAGCTCAAGGAGATCAATCTCGAGATTGATCTCCTTGAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-1342s21c1
Sequence:CCGGCCTTCACTTGCTGGATGGAAACTCGAGTTTCCATCCAGCAAGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020710.2-1619s21c1
Sequence:CCGGCTTCCAGATCCCACAACGAATCTCGAGATTCGTTGTGGGATCTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201226
VALIDATED
LRRC47 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 47
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-3008s1c1
Sequence:CCGGCCTCTGACCTTAAAGGACCATCTCGAGATGGTCCTTTAAGGTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-1381s1c1
Sequence:CCGGCGTGATTTCTTTCCCTCCTATCTCGAGATAGGAGGGAAAGAAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-703s1c1
Sequence:CCGGAGAGATCAACTTTCGAGGAAACTCGAGTTTCCTCGAAAGTTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201226.1-641s1c1
Sequence:CCGGGACCTCTCCAACAACCAACTACTCGAGTAGTTGGTTGTTGGAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201226.1-1396s1c1
Sequence:CCGGTCCTATAACAAACAGTGAGAACTCGAGTTCTCACTGTTTGTTATAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201226
VALIDATED
LRRC47 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 47
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-3008s1c1
Sequence:CCGGCCTCTGACCTTAAAGGACCATCTCGAGATGGTCCTTTAAGGTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-1381s1c1
Sequence:CCGGCGTGATTTCTTTCCCTCCTATCTCGAGATAGGAGGGAAAGAAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-703s1c1
Sequence:CCGGAGAGATCAACTTTCGAGGAAACTCGAGTTTCCTCGAAAGTTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201226.1-641s1c1
Sequence:CCGGGACCTCTCCAACAACCAACTACTCGAGTAGTTGGTTGTTGGAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201226.1-1396s1c1
Sequence:CCGGTCCTATAACAAACAGTGAGAACTCGAGTTCTCACTGTTTGTTATAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201226
VALIDATED
LRRC47 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 47
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-3008s1c1
Sequence:CCGGCCTCTGACCTTAAAGGACCATCTCGAGATGGTCCTTTAAGGTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-1381s1c1
Sequence:CCGGCGTGATTTCTTTCCCTCCTATCTCGAGATAGGAGGGAAAGAAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201226.1-703s1c1
Sequence:CCGGAGAGATCAACTTTCGAGGAAACTCGAGTTTCCTCGAAAGTTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201226.1-641s1c1
Sequence:CCGGGACCTCTCCAACAACCAACTACTCGAGTAGTTGGTTGTTGGAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201226.1-1396s1c1
Sequence:CCGGTCCTATAACAAACAGTGAGAACTCGAGTTCTCACTGTTTGTTATAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)