EMAIL THIS PAGE TO A FRIEND

LRRC48

leucine rich repeat containing 48

75 Gene Product Result for
UniProtKB ID: Q9H069, A8KAE6, Q86SF9, Q86W73, Q8IWG0
Gene ID:
Mouse(74665) leucine rich repeat containing 48
Rat(287371) leucine rich repeat containing 48
domestic guinea pig(100731918) leucine rich repeat containing 48
naked mole-rat(101701002) leucine rich repeat containing 48
sheep(101121436) leucine rich repeat containing 48
Zebrafish(777619) leucine rich repeat containing 48
cow(527539) leucine rich repeat containing 48
Horse(100050795) leucine rich repeat containing 48
domestic cat(101101010) leucine rich repeat containing 48
dog(479525) leucine rich repeat containing 48
chicken(416510) leucine rich repeat containing 48
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031294 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031294 Rosetta Predictions human pricing
NM_001013857 Rosetta Predictions rat pricing
NM_029044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171129 predicted 1209
2 SASI_Hs01_00171130 predicted 636
3 SASI_Hs01_00171131 predicted 373
4 SASI_Hs01_00171132 predicted 398
5 SASI_Hs01_00171133 predicted 1244
6 SASI_Hs01_00171134 predicted 1640
7 SASI_Hs01_00171135 predicted 1034
8 SASI_Hs01_00171136 predicted 1177
9 SASI_Hs01_00171137 predicted 732
10 SASI_Hs01_00171138 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031517 predicted 543
2 SASI_Rn01_00031519 predicted 1202
3 SASI_Rn02_00201122 predicted 673
4 SASI_Rn01_00031520 predicted 727
5 SASI_Rn01_00031521 predicted 1433
6 SASI_Rn01_00031522 predicted 871
7 SASI_Rn01_00031523 predicted 1258
8 SASI_Rn02_00201123 predicted 1262
9 SASI_Rn01_00031524 predicted 1433
10 SASI_Rn02_00201124 predicted 402
11 SASI_Rn01_00031516 predicted 1391
12 SASI_Rn01_00031518 predicted 950
13 SASI_Rn01_00031525 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160742 predicted 536
2 SASI_Mm01_00160743 predicted 620
3 SASI_Mm01_00160744 predicted 614
4 SASI_Mm01_00160745 predicted 713
5 SASI_Mm01_00160746 predicted 781
6 SASI_Mm01_00160747 predicted 1207
7 SASI_Mm01_00160748 predicted 1262
8 SASI_Mm01_00160749 predicted 1612
9 SASI_Mm01_00160750 predicted 1522
10 SASI_Mm01_00160751 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031294
LRRC48 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 48
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-428s1c1
Sequence:CCGGGCAGCTGGACAATAACATCATCTCGAGATGATGTTATTGTCCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1380s1c1
Sequence:CCGGGTTGACATGGTAGGACTGTTTCTCGAGAAACAGTCCTACCATGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1287s1c1
Sequence:CCGGGACATCAGTGAGTTGTTCGATCTCGAGATCGAACAACTCACTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-398s1c1
Sequence:CCGGCCTCTGGCAGTTTGAGAACTTCTCGAGAAGTTCTCAAACTGCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1271s1c1
Sequence:CCGGCCTAGAATGCAGTGCTGACATCTCGAGATGTCAGCACTGCATTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1598s1c1
Sequence:CCGGCCACCTCCTGAAGATTGACAACTCGAGTTGTCAATCTTCAGGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1034s1c1
Sequence:CCGGCCTTGAGACCTACAAGGACAACTCGAGTTGTCCTTGTAGGTCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1239s1c1
Sequence:CCGGGAGTTGGAACTGCCCAACATTCTCGAGAATGTTGGGCAGTTCCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-254s1c1
Sequence:CCGGGATGGACGATGACATGCTCAACTCGAGTTGAGCATGTCATCGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-560s1c1
Sequence:CCGGGAGCTTGTTCAACAACCGGATCTCGAGATCCGGTTGTTGAACAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1604s1c1
Sequence:CCGGCCTGAAGATTGACAATCGAGACTCGAGTCTCGATTGTCAATCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-641s1c1
Sequence:CCGGCCGGATTGACAACATGATGAACTCGAGTTCATCATGTTGTCAATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1715s1c1
Sequence:CCGGGAAGGAGATCAATCAGTACATCTCGAGATGTACTGATTGATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1178s1c1
Sequence:CCGGCAAACGCAAGATTGCCAAATTCTCGAGAATTTGGCAATCTTGCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1046s1c1
Sequence:CCGGCAAGGACAAGTTTGTCATCATCTCGAGATGATGACAAACTTGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031294
LRRC48 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 48
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-428s1c1
Sequence:CCGGGCAGCTGGACAATAACATCATCTCGAGATGATGTTATTGTCCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1380s1c1
Sequence:CCGGGTTGACATGGTAGGACTGTTTCTCGAGAAACAGTCCTACCATGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1287s1c1
Sequence:CCGGGACATCAGTGAGTTGTTCGATCTCGAGATCGAACAACTCACTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-398s1c1
Sequence:CCGGCCTCTGGCAGTTTGAGAACTTCTCGAGAAGTTCTCAAACTGCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1271s1c1
Sequence:CCGGCCTAGAATGCAGTGCTGACATCTCGAGATGTCAGCACTGCATTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1598s1c1
Sequence:CCGGCCACCTCCTGAAGATTGACAACTCGAGTTGTCAATCTTCAGGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1034s1c1
Sequence:CCGGCCTTGAGACCTACAAGGACAACTCGAGTTGTCCTTGTAGGTCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1239s1c1
Sequence:CCGGGAGTTGGAACTGCCCAACATTCTCGAGAATGTTGGGCAGTTCCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-254s1c1
Sequence:CCGGGATGGACGATGACATGCTCAACTCGAGTTGAGCATGTCATCGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-560s1c1
Sequence:CCGGGAGCTTGTTCAACAACCGGATCTCGAGATCCGGTTGTTGAACAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1604s1c1
Sequence:CCGGCCTGAAGATTGACAATCGAGACTCGAGTCTCGATTGTCAATCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-641s1c1
Sequence:CCGGCCGGATTGACAACATGATGAACTCGAGTTCATCATGTTGTCAATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1715s1c1
Sequence:CCGGGAAGGAGATCAATCAGTACATCTCGAGATGTACTGATTGATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1178s1c1
Sequence:CCGGCAAACGCAAGATTGCCAAATTCTCGAGAATTTGGCAATCTTGCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1046s1c1
Sequence:CCGGCAAGGACAAGTTTGTCATCATCTCGAGATGATGACAAACTTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031294
LRRC48 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 48
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-428s1c1
Sequence:CCGGGCAGCTGGACAATAACATCATCTCGAGATGATGTTATTGTCCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1380s1c1
Sequence:CCGGGTTGACATGGTAGGACTGTTTCTCGAGAAACAGTCCTACCATGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1287s1c1
Sequence:CCGGGACATCAGTGAGTTGTTCGATCTCGAGATCGAACAACTCACTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-398s1c1
Sequence:CCGGCCTCTGGCAGTTTGAGAACTTCTCGAGAAGTTCTCAAACTGCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1271s1c1
Sequence:CCGGCCTAGAATGCAGTGCTGACATCTCGAGATGTCAGCACTGCATTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1598s1c1
Sequence:CCGGCCACCTCCTGAAGATTGACAACTCGAGTTGTCAATCTTCAGGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1034s1c1
Sequence:CCGGCCTTGAGACCTACAAGGACAACTCGAGTTGTCCTTGTAGGTCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-1239s1c1
Sequence:CCGGGAGTTGGAACTGCCCAACATTCTCGAGAATGTTGGGCAGTTCCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-254s1c1
Sequence:CCGGGATGGACGATGACATGCTCAACTCGAGTTGAGCATGTCATCGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-560s1c1
Sequence:CCGGGAGCTTGTTCAACAACCGGATCTCGAGATCCGGTTGTTGAACAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1604s1c1
Sequence:CCGGCCTGAAGATTGACAATCGAGACTCGAGTCTCGATTGTCAATCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031294.2-641s1c1
Sequence:CCGGCCGGATTGACAACATGATGAACTCGAGTTCATCATGTTGTCAATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1715s1c1
Sequence:CCGGGAAGGAGATCAATCAGTACATCTCGAGATGTACTGATTGATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1178s1c1
Sequence:CCGGCAAACGCAAGATTGCCAAATTCTCGAGAATTTGGCAATCTTGCGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031294.2-1046s1c1
Sequence:CCGGCAAGGACAAGTTTGTCATCATCTCGAGATGATGACAAACTTGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029044
LRRC48 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 48
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-616s1c1
Sequence:CCGGCCAGATTAGCAACATGATGAACTCGAGTTCATCATGTTGCTAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-1685s1c1
Sequence:CCGGCGAGTGAAGGAGATCAATCAACTCGAGTTGATTGATCTCCTTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-896s1c1
Sequence:CCGGGAACACAAGATGGCGTTTGTTCTCGAGAACAAACGCCATCTTGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-463s1c1
Sequence:CCGGCTGGCTGGATTTGTCCTTTAACTCGAGTTAAAGGACAAATCCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-617s1c1
Sequence:CCGGCAGATTAGCAACATGATGAATCTCGAGATTCATCATGTTGCTAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029044
LRRC48 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 48
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-616s1c1
Sequence:CCGGCCAGATTAGCAACATGATGAACTCGAGTTCATCATGTTGCTAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-1685s1c1
Sequence:CCGGCGAGTGAAGGAGATCAATCAACTCGAGTTGATTGATCTCCTTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-896s1c1
Sequence:CCGGGAACACAAGATGGCGTTTGTTCTCGAGAACAAACGCCATCTTGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-463s1c1
Sequence:CCGGCTGGCTGGATTTGTCCTTTAACTCGAGTTAAAGGACAAATCCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-617s1c1
Sequence:CCGGCAGATTAGCAACATGATGAATCTCGAGATTCATCATGTTGCTAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029044
LRRC48 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 48
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-616s1c1
Sequence:CCGGCCAGATTAGCAACATGATGAACTCGAGTTCATCATGTTGCTAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-1685s1c1
Sequence:CCGGCGAGTGAAGGAGATCAATCAACTCGAGTTGATTGATCTCCTTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-896s1c1
Sequence:CCGGGAACACAAGATGGCGTTTGTTCTCGAGAACAAACGCCATCTTGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-463s1c1
Sequence:CCGGCTGGCTGGATTTGTCCTTTAACTCGAGTTAAAGGACAAATCCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029044.1-617s1c1
Sequence:CCGGCAGATTAGCAACATGATGAATCTCGAGATTCATCATGTTGCTAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)