EMAIL THIS PAGE TO A FRIEND

LRRC49

leucine rich repeat containing 49

63 Gene Product Result for
UniProtKB ID: Q8IUZ0, B7Z366, G5E9T5, H0YLN4, Q9NXM6
Gene ID:
Mouse(102747) leucine rich repeat containing 49
Rat(300763) leucine rich repeat containing 49
chicken(415393) leucine rich repeat containing 49
cow(511727) leucine rich repeat containing 49
Horse(100052408) leucine rich repeat containing 49
domestic cat(101097243) leucine rich repeat containing 49
dog(487626) leucine rich repeat containing 49
sheep(101107966) leucine rich repeat containing 49
naked mole-rat(101725318) leucine rich repeat containing 49
domestic guinea pig(100734576) leucine rich repeat containing 49
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017691 Rosetta Predictions human pricing
NM_001134469 Rosetta Predictions rat pricing
NM_145616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052608 predicted 1743
2 SASI_Hs01_00052609 predicted 782
3 SASI_Hs01_00052610 predicted 2234
4 SASI_Hs02_00350441 predicted 2199
5 SASI_Hs01_00052611 predicted 1716
6 SASI_Hs02_00350442 predicted 1237
7 SASI_Hs01_00052612 predicted 684
8 SASI_Hs01_00052614 predicted 1259
9 SASI_Hs01_00052616 predicted 634
10 SASI_Hs02_00350443 predicted 1435
11 SASI_Hs01_00052607 predicted 932
12 SASI_Hs01_00052613 predicted 443
13 SASI_Hs01_00052615 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256409 predicted 2141
2 SASI_Rn02_00256410 predicted 204
3 SASI_Rn02_00256411 predicted 854
4 SASI_Rn02_00256412 predicted 694
5 SASI_Rn02_00256413 predicted 660
6 SASI_Rn02_00256414 predicted 473
7 SASI_Rn02_00256415 predicted 1440
8 SASI_Rn02_00256416 predicted 1272
9 SASI_Rn02_00256417 predicted 674
10 SASI_Rn02_00256418 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097642 predicted 1069
2 SASI_Mm01_00097643 predicted 1265
3 SASI_Mm01_00097644 predicted 1589
4 SASI_Mm01_00097645 predicted 1061
5 SASI_Mm01_00097646 predicted 1312
6 SASI_Mm01_00097647 predicted 1649
7 SASI_Mm01_00097648 predicted 2078
8 SASI_Mm01_00097649 predicted 1574
9 SASI_Mm01_00097650 predicted 2206
10 SASI_Mm01_00097651 predicted 2119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145616
LRRC49 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 49
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145616.2-2554s1c1
Sequence:CCGGGCTGGGTCAGAAATGCTTCTTCTCGAGAAGAAGCATTTCTGACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1274s1c1
Sequence:CCGGCCATTAACAATGTCGCTCGAACTCGAGTTCGAGCGACATTGTTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1873s1c1
Sequence:CCGGGAAAGGCTCTTTGGAATCTTACTCGAGTAAGATTCCAAAGAGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145616.2-2315s1c1
Sequence:CCGGGATGGCTGCTACTTCAGACTTCTCGAGAAGTCTGAAGTAGCAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1662s1c1
Sequence:CCGGCCTTAAATTCAGGGAGACCAACTCGAGTTGGTCTCCCTGAATTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.2-1921s1c1
Sequence:CCGGCAGTACCGCATGATTTCAATTCTCGAGAATTGAAATCATGCGGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-808s1c1
Sequence:CCGGCATGGAAATCAGATTACCAAACTCGAGTTTGGTAATCTGATTTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-484s21c1
Sequence:CCGGTAAGTCCTTCGCCTCGTAATACTCGAGTATTACGAGGCGAAGGACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-1127s21c1
Sequence:CCGGCAACGGCCTGGATTCACTAACCTCGAGGTTAGTGAATCCAGGCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-1755s1c1
Sequence:CCGGGAAACCCAGTGGTCAACTTTACTCGAGTAAAGTTGACCACTGGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-642s1c1
Sequence:CCGGCTAATCTACAGAGGCTAATATCTCGAGATATTAGCCTCTGTAGATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-1584s1c1
Sequence:CCGGCATTCACGTTCATCGAGTTTGCTCGAGCAAACTCGATGAACGTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-2347s21c1
Sequence:CCGGAGAAGTTCTGCAGGTTGTATGCTCGAGCATACAACCTGCAGAACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145616
LRRC49 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 49
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145616.2-2554s1c1
Sequence:CCGGGCTGGGTCAGAAATGCTTCTTCTCGAGAAGAAGCATTTCTGACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1274s1c1
Sequence:CCGGCCATTAACAATGTCGCTCGAACTCGAGTTCGAGCGACATTGTTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1873s1c1
Sequence:CCGGGAAAGGCTCTTTGGAATCTTACTCGAGTAAGATTCCAAAGAGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145616.2-2315s1c1
Sequence:CCGGGATGGCTGCTACTTCAGACTTCTCGAGAAGTCTGAAGTAGCAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1662s1c1
Sequence:CCGGCCTTAAATTCAGGGAGACCAACTCGAGTTGGTCTCCCTGAATTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.2-1921s1c1
Sequence:CCGGCAGTACCGCATGATTTCAATTCTCGAGAATTGAAATCATGCGGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-808s1c1
Sequence:CCGGCATGGAAATCAGATTACCAAACTCGAGTTTGGTAATCTGATTTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-484s21c1
Sequence:CCGGTAAGTCCTTCGCCTCGTAATACTCGAGTATTACGAGGCGAAGGACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-1127s21c1
Sequence:CCGGCAACGGCCTGGATTCACTAACCTCGAGGTTAGTGAATCCAGGCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-1755s1c1
Sequence:CCGGGAAACCCAGTGGTCAACTTTACTCGAGTAAAGTTGACCACTGGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-642s1c1
Sequence:CCGGCTAATCTACAGAGGCTAATATCTCGAGATATTAGCCTCTGTAGATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-1584s1c1
Sequence:CCGGCATTCACGTTCATCGAGTTTGCTCGAGCAAACTCGATGAACGTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-2347s21c1
Sequence:CCGGAGAAGTTCTGCAGGTTGTATGCTCGAGCATACAACCTGCAGAACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145616
LRRC49 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 49
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145616.2-2554s1c1
Sequence:CCGGGCTGGGTCAGAAATGCTTCTTCTCGAGAAGAAGCATTTCTGACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1274s1c1
Sequence:CCGGCCATTAACAATGTCGCTCGAACTCGAGTTCGAGCGACATTGTTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1873s1c1
Sequence:CCGGGAAAGGCTCTTTGGAATCTTACTCGAGTAAGATTCCAAAGAGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145616.2-2315s1c1
Sequence:CCGGGATGGCTGCTACTTCAGACTTCTCGAGAAGTCTGAAGTAGCAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-1662s1c1
Sequence:CCGGCCTTAAATTCAGGGAGACCAACTCGAGTTGGTCTCCCTGAATTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.2-1921s1c1
Sequence:CCGGCAGTACCGCATGATTTCAATTCTCGAGAATTGAAATCATGCGGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145616.2-808s1c1
Sequence:CCGGCATGGAAATCAGATTACCAAACTCGAGTTTGGTAATCTGATTTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-484s21c1
Sequence:CCGGTAAGTCCTTCGCCTCGTAATACTCGAGTATTACGAGGCGAAGGACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-1127s21c1
Sequence:CCGGCAACGGCCTGGATTCACTAACCTCGAGGTTAGTGAATCCAGGCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-1755s1c1
Sequence:CCGGGAAACCCAGTGGTCAACTTTACTCGAGTAAAGTTGACCACTGGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-642s1c1
Sequence:CCGGCTAATCTACAGAGGCTAATATCTCGAGATATTAGCCTCTGTAGATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145616.3-1584s1c1
Sequence:CCGGCATTCACGTTCATCGAGTTTGCTCGAGCAAACTCGATGAACGTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145616.4-2347s21c1
Sequence:CCGGAGAAGTTCTGCAGGTTGTATGCTCGAGCATACAACCTGCAGAACTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017691
VALIDATED
LRRC49 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 49
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-1091s1c1
Sequence:CCGGGCTCAAGAGTCATGGTACAAACTCGAGTTTGTACCATGACTCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-1543s1c1
Sequence:CCGGGAGTGTTCAAACAGCAGGAATCTCGAGATTCCTGCTGTTTGAACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-550s1c1
Sequence:CCGGGCTGACCGTATGTCCTATCATCTCGAGATGATAGGACATACGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_017691.2-2239s21c1
Sequence:CCGGAGTCATAGAAATTCGCAATAACTCGAGTTATTGCGAATTTCTATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017691.2-432s21c1
Sequence:CCGGGTAGGCAAGGTGATCATATTACTCGAGTAATATGATCACCTTGCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017691.2-2604s21c1
Sequence:CCGGTAGCCCAAAGCACGTAGTATTCTCGAGAATACTACGTGCTTTGGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017691.2-302s21c1
Sequence:CCGGTGCGGGCTTCATCTGGTTATTCTCGAGAATAACCAGATGAAGCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017691
VALIDATED
LRRC49 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 49
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-1091s1c1
Sequence:CCGGGCTCAAGAGTCATGGTACAAACTCGAGTTTGTACCATGACTCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-1543s1c1
Sequence:CCGGGAGTGTTCAAACAGCAGGAATCTCGAGATTCCTGCTGTTTGAACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-550s1c1
Sequence:CCGGGCTGACCGTATGTCCTATCATCTCGAGATGATAGGACATACGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_017691.2-2239s21c1
Sequence:CCGGAGTCATAGAAATTCGCAATAACTCGAGTTATTGCGAATTTCTATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017691.2-432s21c1
Sequence:CCGGGTAGGCAAGGTGATCATATTACTCGAGTAATATGATCACCTTGCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017691.2-2604s21c1
Sequence:CCGGTAGCCCAAAGCACGTAGTATTCTCGAGAATACTACGTGCTTTGGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017691.2-302s21c1
Sequence:CCGGTGCGGGCTTCATCTGGTTATTCTCGAGAATAACCAGATGAAGCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017691
VALIDATED
LRRC49 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 49
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-1091s1c1
Sequence:CCGGGCTCAAGAGTCATGGTACAAACTCGAGTTTGTACCATGACTCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-1543s1c1
Sequence:CCGGGAGTGTTCAAACAGCAGGAATCTCGAGATTCCTGCTGTTTGAACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017691.1-550s1c1
Sequence:CCGGGCTGACCGTATGTCCTATCATCTCGAGATGATAGGACATACGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_017691.2-2239s21c1
Sequence:CCGGAGTCATAGAAATTCGCAATAACTCGAGTTATTGCGAATTTCTATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017691.2-432s21c1
Sequence:CCGGGTAGGCAAGGTGATCATATTACTCGAGTAATATGATCACCTTGCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017691.2-2604s21c1
Sequence:CCGGTAGCCCAAAGCACGTAGTATTCTCGAGAATACTACGTGCTTTGGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_017691.2-302s21c1
Sequence:CCGGTGCGGGCTTCATCTGGTTATTCTCGAGAATAACCAGATGAAGCCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)