EMAIL THIS PAGE TO A FRIEND

LRRC4

leucine rich repeat containing 4

118 Gene Product Result for
Synonyms: NGL-2
UniProtKB ID: Q9HBW1, A4D0Y9, Q14DU9, Q6ZMI8, Q96A85
Gene ID:
Human(64101) Summary: This gene is significantly downregulated in primary brain tumors. The exact function of the protein encoded by this gene is unknown. [provided by RefSeq, Jul 2008]
Mouse(192198) leucine rich repeat containing 4
Rat(641521) leucine rich repeat containing 4
cow(525767) leucine rich repeat containing 4
Horse(100056742) leucine rich repeat containing 4
dog(607997) leucine rich repeat containing 4
domestic cat(101100118) leucine rich repeat containing 4
domestic guinea pig(100727245) leucine rich repeat containing 4
naked mole-rat(101723646) leucine rich repeat containing 4
Domestic Rabbit(100344455) leucine rich repeat containing 4
sheep(101109960) leucine rich repeat containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1567 Human LRRC4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022143 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022143 Rosetta Predictions human pricing
NM_001037336 Rosetta Predictions rat pricing
NM_138682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095248 predicted 1569
2 SASI_Hs01_00095249 predicted 682
3 SASI_Hs02_00355555 predicted 1532
4 SASI_Hs01_00095250 predicted 881
5 SASI_Hs01_00095251 predicted 676
6 SASI_Hs01_00095252 predicted 1395
7 SASI_Hs01_00095253 predicted 936
8 SASI_Hs01_00095254 predicted 1466
9 SASI_Hs01_00095256 predicted 959
10 SASI_Hs01_00095257 predicted 1046
11 SASI_Hs01_00095255 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080671 predicted 1492
2 SASI_Rn01_00080672 predicted 1537
3 SASI_Rn01_00080674 predicted 1038
4 SASI_Rn01_00080675 predicted 1002
5 SASI_Rn01_00080676 predicted 834
6 SASI_Rn01_00080677 predicted 904
7 SASI_Rn02_00204367 predicted 766
8 SASI_Rn01_00080678 predicted 1353
9 SASI_Rn01_00080679 predicted 1011
10 SASI_Rn01_00080680 predicted 465
11 SASI_Rn01_00080673 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339766 predicted 1529
2 SASI_Mm01_00041465 predicted 1029
3 SASI_Mm02_00339767 predicted 866
4 SASI_Mm02_00339768 predicted 362
5 SASI_Mm01_00041469 predicted 1381
6 SASI_Mm01_00041470 predicted 928
7 SASI_Mm01_00041471 predicted 1047
8 SASI_Mm01_00041472 predicted 1371
9 SASI_Mm01_00041473 predicted 277
10 SASI_Mm02_00339769 predicted 945
11 SASI_Mm01_00041464 predicted 849
12 SASI_Mm01_00041466 predicted 1446
13 SASI_Mm01_00041467 predicted 774
14 SASI_Mm01_00041468 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022143
LRRC4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-692s1c1
Sequence:CCGGGTATATCTCTGAGGGAGCTTTCTCGAGAAAGCTCCCTCAGAGATATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-677s1c1
Sequence:CCGGGCTCAAGAAGCTGGAGTATATCTCGAGATATACTCCAGCTTCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-2032s1c1
Sequence:CCGGCCACTATCTCTGAACCTTATACTCGAGTATAAGGTTCAGAGATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-3206s1c1
Sequence:CCGGGCTGATTCATTAGGGATTATTCTCGAGAATAATCCCTAATGAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-1084s1c1
Sequence:CCGGGAGAGTATATACCCACCAATTCTCGAGAATTGGTGGGTATATACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2793s1c1
Sequence:CCGGCCTGACAGAATTGCTTAGAAACTCGAGTTTCTAAGCAATTCTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-1760s1c1
Sequence:CCGGCGCCATGTTGATTGTCTTCTACTCGAGTAGAAGACAATCAACATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2856s1c1
Sequence:CCGGGCTTTCACATTGCACCAGATTCTCGAGAATCTGGTGCAATGTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2138s1c1
Sequence:CCGGGCACACAAAGACAGCAACTTTCTCGAGAAAGTTGCTGTCTTTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022143
LRRC4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-692s1c1
Sequence:CCGGGTATATCTCTGAGGGAGCTTTCTCGAGAAAGCTCCCTCAGAGATATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-677s1c1
Sequence:CCGGGCTCAAGAAGCTGGAGTATATCTCGAGATATACTCCAGCTTCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-2032s1c1
Sequence:CCGGCCACTATCTCTGAACCTTATACTCGAGTATAAGGTTCAGAGATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-3206s1c1
Sequence:CCGGGCTGATTCATTAGGGATTATTCTCGAGAATAATCCCTAATGAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-1084s1c1
Sequence:CCGGGAGAGTATATACCCACCAATTCTCGAGAATTGGTGGGTATATACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2793s1c1
Sequence:CCGGCCTGACAGAATTGCTTAGAAACTCGAGTTTCTAAGCAATTCTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-1760s1c1
Sequence:CCGGCGCCATGTTGATTGTCTTCTACTCGAGTAGAAGACAATCAACATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2856s1c1
Sequence:CCGGGCTTTCACATTGCACCAGATTCTCGAGAATCTGGTGCAATGTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2138s1c1
Sequence:CCGGGCACACAAAGACAGCAACTTTCTCGAGAAAGTTGCTGTCTTTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022143
LRRC4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-692s1c1
Sequence:CCGGGTATATCTCTGAGGGAGCTTTCTCGAGAAAGCTCCCTCAGAGATATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-677s1c1
Sequence:CCGGGCTCAAGAAGCTGGAGTATATCTCGAGATATACTCCAGCTTCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-2032s1c1
Sequence:CCGGCCACTATCTCTGAACCTTATACTCGAGTATAAGGTTCAGAGATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-3206s1c1
Sequence:CCGGGCTGATTCATTAGGGATTATTCTCGAGAATAATCCCTAATGAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-1084s1c1
Sequence:CCGGGAGAGTATATACCCACCAATTCTCGAGAATTGGTGGGTATATACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160001    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2793s1c1
Sequence:CCGGCCTGACAGAATTGCTTAGAAACTCGAGTTTCTAAGCAATTCTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022143.3-1760s1c1
Sequence:CCGGCGCCATGTTGATTGTCTTCTACTCGAGTAGAAGACAATCAACATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2856s1c1
Sequence:CCGGGCTTTCACATTGCACCAGATTCTCGAGAATCTGGTGCAATGTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022143.3-2138s1c1
Sequence:CCGGGCACACAAAGACAGCAACTTTCTCGAGAAAGTTGCTGTCTTTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138682
LRRC4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-1033s1c1
Sequence:CCGGCGGGAGTATATCCCAACCAATCTCGAGATTGGTTGGGATATACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-909s1c1
Sequence:CCGGCCACAATAACCTCTCATCTTTCTCGAGAAAGATGAGAGGTTATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-331s1c1
Sequence:CCGGCGGTATCTCAACCTCATGGAACTCGAGTTCCATGAGGTTGAGATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-1883s1c1
Sequence:CCGGCCACAATACATGACCATATTACTCGAGTAATATGGTCATGTATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-908s1c1
Sequence:CCGGCCCACAATAACCTCTCATCTTCTCGAGAAGATGAGAGGTTATTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138682
LRRC4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-1033s1c1
Sequence:CCGGCGGGAGTATATCCCAACCAATCTCGAGATTGGTTGGGATATACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-909s1c1
Sequence:CCGGCCACAATAACCTCTCATCTTTCTCGAGAAAGATGAGAGGTTATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-331s1c1
Sequence:CCGGCGGTATCTCAACCTCATGGAACTCGAGTTCCATGAGGTTGAGATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-1883s1c1
Sequence:CCGGCCACAATACATGACCATATTACTCGAGTAATATGGTCATGTATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-908s1c1
Sequence:CCGGCCCACAATAACCTCTCATCTTCTCGAGAAGATGAGAGGTTATTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138682
LRRC4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-1033s1c1
Sequence:CCGGCGGGAGTATATCCCAACCAATCTCGAGATTGGTTGGGATATACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-909s1c1
Sequence:CCGGCCACAATAACCTCTCATCTTTCTCGAGAAAGATGAGAGGTTATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-331s1c1
Sequence:CCGGCGGTATCTCAACCTCATGGAACTCGAGTTCCATGAGGTTGAGATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-1883s1c1
Sequence:CCGGCCACAATACATGACCATATTACTCGAGTAATATGGTCATGTATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138682.1-908s1c1
Sequence:CCGGCCCACAATAACCTCTCATCTTCTCGAGAAGATGAGAGGTTATTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)