EMAIL THIS PAGE TO A FRIEND

LRRC4B

leucine rich repeat containing 4B

78 Gene Product Result for
Synonyms: HSM LRIG4
UniProtKB ID: Q9NT99, Q3ZCQ4, Q58F20
Gene ID:
Mouse(272381) leucine rich repeat containing 4B
Rat(308571) leucine rich repeat containing 4B
domestic guinea pig(100719023) leucine rich repeat containing 4B
Domestic Rabbit(100345658) leucine rich repeat containing 4B
sheep(101118298) leucine rich repeat containing 4B
Zebrafish(100535350) leucine rich repeat containing 4B
cow(539607) leucine rich repeat containing 4B
domestic cat(101098910) leucine rich repeat containing 4B
dog(484361) leucine rich repeat containing 4B
chicken(100857901) leucine rich repeat containing 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080457 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008021 MISSION® esiRNA esiRNA targeting human LRRC4B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080457 Rosetta Predictions human pricing
XM_292778 Rosetta Predictions human pricing
XM_001077685 Rosetta Predictions rat pricing
XM_218615 Rosetta Predictions rat pricing
NM_198250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315026 predicted 2550
2 SASI_Hs02_00315027 predicted 480
3 SASI_Hs02_00315028 predicted 1870
4 SASI_Hs02_00315029 predicted 1212
5 SASI_Hs02_00315030 predicted 778
6 SASI_Hs02_00315031 predicted 879
7 SASI_Hs02_00315032 predicted 1911
8 SASI_Hs02_00315033 predicted 467
9 SASI_Hs02_00315034 predicted 1794
10 SASI_Hs02_00315035 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250883 predicted 2550
2 SASI_Hs01_00250884 predicted 480
3 SASI_Hs01_00250885 predicted 1877
4 SASI_Hs01_00250886 predicted 383
5 SASI_Hs01_00250887 predicted 1206
6 SASI_Hs01_00250888 predicted 772
7 SASI_Hs01_00250889 predicted 878
8 SASI_Hs01_00250890 predicted 1912
9 SASI_Hs01_00250891 predicted 471
10 SASI_Hs01_00250892 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358084 predicted 463
2 SASI_Rn02_00358085 predicted 2191
3 SASI_Rn02_00358086 predicted 529
4 SASI_Rn02_00358087 predicted 490
5 SASI_Rn02_00358088 predicted 1739
6 SASI_Rn02_00358089 predicted 1762
7 SASI_Rn02_00358090 predicted 2130
8 SASI_Rn02_00358091 predicted 724
9 SASI_Rn02_00358092 predicted 2180
10 SASI_Rn02_00358093 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167213 predicted 465
2 SASI_Rn01_00167214 predicted 2188
3 SASI_Rn01_00167216 predicted 530
4 SASI_Rn01_00167218 predicted 490
5 SASI_Rn01_00167219 predicted 1738
6 SASI_Rn01_00167220 predicted 1761
7 SASI_Rn01_00167221 predicted 2136
8 SASI_Rn02_00377871 predicted 724
9 SASI_Rn01_00167222 predicted 2183
10 SASI_Rn02_00377872 predicted 649
11 SASI_Rn01_00167215 predicted 383
12 SASI_Rn01_00167217 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190151 predicted 470
2 SASI_Mm01_00190152 predicted 2037
3 SASI_Mm02_00350902 predicted 1018
4 SASI_Mm01_00190153 predicted 696
5 SASI_Mm01_00190154 predicted 2183
6 SASI_Mm01_00190155 predicted 1759
7 SASI_Mm01_00190156 predicted 656
8 SASI_Mm01_00190157 predicted 1131
9 SASI_Mm01_00190158 predicted 1736
10 SASI_Mm01_00190159 predicted 927
11 SASI_Mm01_00190160 predicted 388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198250
LRRC4B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 4B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198250.1-2647s21c1
Sequence:CCGGGAAGGGAGGTTTGCGTCAATCCTCGAGGATTGACGCAAACCTCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198250.1-661s21c1
Sequence:CCGGTGAAGAGGCTGGAGTACATATCTCGAGATATGTACTCCAGCCTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198250.1-1386s21c1
Sequence:CCGGTACACGTGCATGGTGACAAACCTCGAGGTTTGTCACCATGCACGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198250.1-2508s1c1
Sequence:CCGGTCCTACTCCTTCACCCTCAAACTCGAGTTTGAGGGTGAAGGAGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-1320s1c1
Sequence:CCGGCGCATTTCAGTGCTGCACGATCTCGAGATCGTGCAGCACTGAAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-2185s1c1
Sequence:CCGGAGAACGTGCAAGAGACACAAACTCGAGTTTGTGTCTCTTGCACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-725s1c1
Sequence:CCGGCCTGGGCATGTGCAACCTAAACTCGAGTTTAGGTTGCACATGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-2189s1c1
Sequence:CCGGCGTGCAAGAGACACAAATCTACTCGAGTAGATTTGTGTCTCTTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198250
LRRC4B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 4B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198250.1-2647s21c1
Sequence:CCGGGAAGGGAGGTTTGCGTCAATCCTCGAGGATTGACGCAAACCTCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198250.1-661s21c1
Sequence:CCGGTGAAGAGGCTGGAGTACATATCTCGAGATATGTACTCCAGCCTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198250.1-1386s21c1
Sequence:CCGGTACACGTGCATGGTGACAAACCTCGAGGTTTGTCACCATGCACGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198250.1-2508s1c1
Sequence:CCGGTCCTACTCCTTCACCCTCAAACTCGAGTTTGAGGGTGAAGGAGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-1320s1c1
Sequence:CCGGCGCATTTCAGTGCTGCACGATCTCGAGATCGTGCAGCACTGAAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-2185s1c1
Sequence:CCGGAGAACGTGCAAGAGACACAAACTCGAGTTTGTGTCTCTTGCACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-725s1c1
Sequence:CCGGCCTGGGCATGTGCAACCTAAACTCGAGTTTAGGTTGCACATGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-2189s1c1
Sequence:CCGGCGTGCAAGAGACACAAATCTACTCGAGTAGATTTGTGTCTCTTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198250
LRRC4B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 4B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198250.1-2647s21c1
Sequence:CCGGGAAGGGAGGTTTGCGTCAATCCTCGAGGATTGACGCAAACCTCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198250.1-661s21c1
Sequence:CCGGTGAAGAGGCTGGAGTACATATCTCGAGATATGTACTCCAGCCTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198250.1-1386s21c1
Sequence:CCGGTACACGTGCATGGTGACAAACCTCGAGGTTTGTCACCATGCACGTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198250.1-2508s1c1
Sequence:CCGGTCCTACTCCTTCACCCTCAAACTCGAGTTTGAGGGTGAAGGAGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-1320s1c1
Sequence:CCGGCGCATTTCAGTGCTGCACGATCTCGAGATCGTGCAGCACTGAAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-2185s1c1
Sequence:CCGGAGAACGTGCAAGAGACACAAACTCGAGTTTGTGTCTCTTGCACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-725s1c1
Sequence:CCGGCCTGGGCATGTGCAACCTAAACTCGAGTTTAGGTTGCACATGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198250.1-2189s1c1
Sequence:CCGGCGTGCAAGAGACACAAATCTACTCGAGTAGATTTGTGTCTCTTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080457
LRRC4B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 4B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000246327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-1880s21c1
Sequence:CCGGCTTCGTGGCCATCACGTTCATCTCGAGATGAACGTGATGGCCACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-491s21c1
Sequence:CCGGCAAGAACCTGGTGCGCAAGATCTCGAGATCTTGCGCACCAGGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080457.1-2537s21c1
Sequence:CCGGAGGAGAAGTGGCCTGAGTTCTCTCGAGAGAACTCAGGCCACTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-2257s21c1
Sequence:CCGGACGTGCAAGAGACGCAGATCTCTCGAGAGATCTGCGTCTCTTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080457
LRRC4B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 4B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000246327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-1880s21c1
Sequence:CCGGCTTCGTGGCCATCACGTTCATCTCGAGATGAACGTGATGGCCACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-491s21c1
Sequence:CCGGCAAGAACCTGGTGCGCAAGATCTCGAGATCTTGCGCACCAGGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080457.1-2537s21c1
Sequence:CCGGAGGAGAAGTGGCCTGAGTTCTCTCGAGAGAACTCAGGCCACTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-2257s21c1
Sequence:CCGGACGTGCAAGAGACGCAGATCTCTCGAGAGATCTGCGTCTCTTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080457
LRRC4B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 4B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000246327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-1880s21c1
Sequence:CCGGCTTCGTGGCCATCACGTTCATCTCGAGATGAACGTGATGGCCACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-491s21c1
Sequence:CCGGCAAGAACCTGGTGCGCAAGATCTCGAGATCTTGCGCACCAGGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080457.1-2537s21c1
Sequence:CCGGAGGAGAAGTGGCCTGAGTTCTCTCGAGAGAACTCAGGCCACTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080457.1-2257s21c1
Sequence:CCGGACGTGCAAGAGACGCAGATCTCTCGAGAGATCTGCGTCTCTTGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)