EMAIL THIS PAGE TO A FRIEND

LRRC4C

leucine rich repeat containing 4C

59 Gene Product Result for
Synonyms: NGL-1 NGL1
UniProtKB ID: Q9HCJ2, A8K0T1, Q7L0N3
Gene ID:
Human(57689) Summary: NGL1 is a specific binding partner for netrin G1 (NTNG1; MIM 608818), which is a member of the netrin family of axon guidance molecules (Lin et al., 2003 [PubMed 14595443]
Mouse(241568) leucine rich repeat containing 4C
Rat(311236) leucine rich repeat containing 4C
Zebrafish(553785) leucine rich repeat containing 4C
chicken(428862) leucine rich repeat containing 4C
cow(528664) leucine rich repeat containing 4C
Horse(100049944) leucine rich repeat containing 4C
domestic cat(101097020) leucine rich repeat containing 4C
dog(483417) leucine rich repeat containing 4C
sheep(101108158) leucine rich repeat containing 4C
naked mole-rat(101721726) leucine rich repeat containing 4C
domestic guinea pig(100715211) leucine rich repeat containing 4C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1595 Human NGL-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020929 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007571 MISSION® esiRNA esiRNA targeting human LRRC4C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020929 Rosetta Predictions human pricing
NM_001107753 Rosetta Predictions rat pricing
NM_178725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185329 predicted 2935
2 SASI_Hs02_00354317 predicted 2251
3 SASI_Hs02_00354318 predicted 3104
4 SASI_Hs01_00185330 predicted 2285
5 SASI_Hs01_00185331 predicted 2768
6 SASI_Hs01_00185332 predicted 2314
7 SASI_Hs01_00185333 predicted 3511
8 SASI_Hs01_00185335 predicted 2553
9 SASI_Hs01_00185336 predicted 2710
10 SASI_Hs01_00185337 predicted 2367
11 SASI_Hs01_00185328 predicted 2953
12 SASI_Hs01_00185334 predicted 2351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231925 predicted 1659
2 SASI_Rn02_00231926 predicted 2130
3 SASI_Rn02_00231927 predicted 1419
4 SASI_Rn02_00231928 predicted 1711
5 SASI_Rn02_00231929 predicted 2605
6 SASI_Rn02_00231930 predicted 1671
7 SASI_Rn02_00231931 predicted 1638
8 SASI_Rn02_00231932 predicted 3173
9 SASI_Rn02_00231933 predicted 2536
10 SASI_Rn02_00231934 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147542 predicted 1182
2 SASI_Mm01_00147543 predicted 2074
3 SASI_Mm01_00147544 predicted 1109
4 SASI_Mm01_00147545 predicted 1260
5 SASI_Mm01_00147546 predicted 1241
6 SASI_Mm01_00147547 predicted 1662
7 SASI_Mm02_00349253 predicted 1604
8 SASI_Mm01_00147549 predicted 904
9 SASI_Mm01_00147550 predicted 2136
10 SASI_Mm01_00147551 predicted 1550
11 SASI_Mm01_00147548 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178725
LRRC4C MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 4C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178725.3-3212s1c1
Sequence:CCGGGCCCTTATGAAATAGTCAAATCTCGAGATTTGACTATTTCATAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-1158s1c1
Sequence:CCGGGCACTTAGAAATCCTCCAGTTCTCGAGAACTGGAGGATTTCTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2739s1c1
Sequence:CCGGCCGAATGAACTCTAAAGACAACTCGAGTTGTCTTTAGAGTTCATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2177s1c1
Sequence:CCGGCCTTGAATGTTACTGCGGCAACTCGAGTTGCCGCAGTAACATTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2406s1c1
Sequence:CCGGCCCAGGAATTGATGAGGTCATCTCGAGATGACCTCATCAATTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178725
LRRC4C MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 4C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178725.3-3212s1c1
Sequence:CCGGGCCCTTATGAAATAGTCAAATCTCGAGATTTGACTATTTCATAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-1158s1c1
Sequence:CCGGGCACTTAGAAATCCTCCAGTTCTCGAGAACTGGAGGATTTCTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2739s1c1
Sequence:CCGGCCGAATGAACTCTAAAGACAACTCGAGTTGTCTTTAGAGTTCATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2177s1c1
Sequence:CCGGCCTTGAATGTTACTGCGGCAACTCGAGTTGCCGCAGTAACATTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2406s1c1
Sequence:CCGGCCCAGGAATTGATGAGGTCATCTCGAGATGACCTCATCAATTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178725
LRRC4C MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 4C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178725.3-3212s1c1
Sequence:CCGGGCCCTTATGAAATAGTCAAATCTCGAGATTTGACTATTTCATAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-1158s1c1
Sequence:CCGGGCACTTAGAAATCCTCCAGTTCTCGAGAACTGGAGGATTTCTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2739s1c1
Sequence:CCGGCCGAATGAACTCTAAAGACAACTCGAGTTGTCTTTAGAGTTCATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2177s1c1
Sequence:CCGGCCTTGAATGTTACTGCGGCAACTCGAGTTGCCGCAGTAACATTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178725.3-2406s1c1
Sequence:CCGGCCCAGGAATTGATGAGGTCATCTCGAGATGACCTCATCAATTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020929
LRRC4C MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 4C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2367s1c1
Sequence:CCGGCGTCTTACTACCATCCCGAATCTCGAGATTCGGGATGGTAGTAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3649s1c1
Sequence:CCGGCAACAAGGACTGTTGAAATTACTCGAGTAATTTCAACAGTCCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2846s1c1
Sequence:CCGGGCGGATACATTTACATCACAACTCGAGTTGTGATGTAAATGTATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3000s1c1
Sequence:CCGGCAGAATTACTTCACATGCTATCTCGAGATAGCATGTGAAGTAATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3845s1c1
Sequence:CCGGCCGAATGAACTCTAAAGACAACTCGAGTTGTCTTTAGAGTTCATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2561s1c1
Sequence:CCGGGAGGTATTTGAACCTTGCCATCTCGAGATGGCAAGGTTCAAATACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3256s1c1
Sequence:CCGGCCGTTGGGAATACTACTGCTTCTCGAGAAGCAGTAGTATTCCCAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2255s1c1
Sequence:CCGGGCACTTGAGACACTTGGAAATCTCGAGATTTCCAAGTGTCTCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3179s1c1
Sequence:CCGGGCTCAGTGATGGTACGTTAAACTCGAGTTTAACGTACCATCACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020929
LRRC4C MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 4C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2367s1c1
Sequence:CCGGCGTCTTACTACCATCCCGAATCTCGAGATTCGGGATGGTAGTAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3649s1c1
Sequence:CCGGCAACAAGGACTGTTGAAATTACTCGAGTAATTTCAACAGTCCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2846s1c1
Sequence:CCGGGCGGATACATTTACATCACAACTCGAGTTGTGATGTAAATGTATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3000s1c1
Sequence:CCGGCAGAATTACTTCACATGCTATCTCGAGATAGCATGTGAAGTAATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3845s1c1
Sequence:CCGGCCGAATGAACTCTAAAGACAACTCGAGTTGTCTTTAGAGTTCATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2561s1c1
Sequence:CCGGGAGGTATTTGAACCTTGCCATCTCGAGATGGCAAGGTTCAAATACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3256s1c1
Sequence:CCGGCCGTTGGGAATACTACTGCTTCTCGAGAAGCAGTAGTATTCCCAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2255s1c1
Sequence:CCGGGCACTTGAGACACTTGGAAATCTCGAGATTTCCAAGTGTCTCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3179s1c1
Sequence:CCGGGCTCAGTGATGGTACGTTAAACTCGAGTTTAACGTACCATCACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020929
LRRC4C MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 4C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2367s1c1
Sequence:CCGGCGTCTTACTACCATCCCGAATCTCGAGATTCGGGATGGTAGTAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3649s1c1
Sequence:CCGGCAACAAGGACTGTTGAAATTACTCGAGTAATTTCAACAGTCCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2846s1c1
Sequence:CCGGGCGGATACATTTACATCACAACTCGAGTTGTGATGTAAATGTATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3000s1c1
Sequence:CCGGCAGAATTACTTCACATGCTATCTCGAGATAGCATGTGAAGTAATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3845s1c1
Sequence:CCGGCCGAATGAACTCTAAAGACAACTCGAGTTGTCTTTAGAGTTCATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2561s1c1
Sequence:CCGGGAGGTATTTGAACCTTGCCATCTCGAGATGGCAAGGTTCAAATACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3256s1c1
Sequence:CCGGCCGTTGGGAATACTACTGCTTCTCGAGAAGCAGTAGTATTCCCAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-2255s1c1
Sequence:CCGGGCACTTGAGACACTTGGAAATCTCGAGATTTCCAAGTGTCTCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020929.1-3179s1c1
Sequence:CCGGGCTCAGTGATGGTACGTTAAACTCGAGTTTAACGTACCATCACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)