EMAIL THIS PAGE TO A FRIEND

LRRC55

leucine rich repeat containing 55

228 Gene Product Result for
UniProtKB ID: Q6ZSA7, A7E2U7, B2RN81
Gene ID:
Mouse(241528) leucine rich repeat containing 55
Rat(311171) leucine rich repeat containing 55
chicken(100858394) leucine rich repeat containing 55
domestic cat(101086675) leucine rich repeat containing 55
Horse(100066848) leucine rich repeat containing 55
cow(615203) leucine rich repeat containing 55
dog(483499) leucine rich repeat containing 55
domestic guinea pig(100714277) leucine rich repeat containing 55
naked mole-rat(101699343) leucine rich repeat containing 55
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048961 MISSION® esiRNA esiRNA human LRRC55 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005210 Rosetta Predictions human pricing
NM_001122975 Rosetta Predictions rat pricing
NM_001033346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243030 predicted 384
2 SASI_Hs01_00243031 predicted 627
3 SASI_Hs01_00243032 predicted 926
4 SASI_Hs01_00243033 predicted 619
5 SASI_Hs01_00243034 predicted 1651
6 SASI_Hs01_00243035 predicted 1628
7 SASI_Hs01_00243036 predicted 201
8 SASI_Hs01_00243037 predicted 909
9 SASI_Hs01_00243038 predicted 456
10 SASI_Hs01_00243039 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252723 predicted 1086
2 SASI_Rn02_00252724 predicted 425
3 SASI_Rn02_00252725 predicted 1236
4 SASI_Rn02_00252726 predicted 196
5 SASI_Rn02_00252727 predicted 612
6 SASI_Rn02_00252728 predicted 1027
7 SASI_Rn02_00252729 predicted 1226
8 SASI_Rn02_00252730 predicted 585
9 SASI_Rn02_00252731 predicted 287
10 SASI_Rn02_00252732 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171736 predicted 1006
2 SASI_Mm01_00171738 predicted 419
3 SASI_Mm02_00288609 predicted 423
4 SASI_Mm02_00288610 predicted 404
5 SASI_Mm02_00288611 predicted 562
6 SASI_Mm02_00288612 predicted 202
7 SASI_Mm02_00288613 predicted 924
8 SASI_Mm02_00288614 predicted 394
9 SASI_Mm02_00288615 predicted 904
10 SASI_Mm02_00288616 predicted 304
11 SASI_Mm01_00171734 predicted 1209
12 SASI_Mm01_00171735 predicted 1289
13 SASI_Mm01_00171737 predicted 1299
14 SASI_Mm01_00171739 predicted 1446
15 SASI_Mm01_00171740 predicted 1189
16 SASI_Mm01_00171741 predicted 943
17 SASI_Mm01_00171742 predicted 1365
18 SASI_Mm01_00171743 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005210
LRRC55 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 55
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-559s1c1
Sequence:CCGGGATTTGCACAACAACTCCTTACTCGAGTAAGGAGTTGTTGTGCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005210.1-3175s1c1
Sequence:CCGGCCTGCTTTACAATGTGTAGATCTCGAGATCTACACATTGTAAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-525s1c1
Sequence:CCGGCTACCTCACATGCTACATGGACTCGAGTCCATGTAGCATGTGAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-204s1c1
Sequence:CCGGGTCACAGACTCTCGATTCCATCTCGAGATGGAATCGAGAGTCTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-200s1c1
Sequence:CCGGCTGTGTCACAGACTCTCGATTCTCGAGAATCGAGAGTCTGTGACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-1151s1c1
Sequence:CCGGCCAGTGAAGAGGAAGAGATCTCTCGAGAGATCTCTTCCTCTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-393s1c1
Sequence:CCGGCGTCCTTTGCACATGCCGTAACTCGAGTTACGGCATGTGCAAAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-1038s1c1
Sequence:CCGGCCTGGATGATTACCTATTCATCTCGAGATGAATAGGTAATCATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005210.2-1649s21c1
Sequence:CCGGGAACAGTTCCTGGTCACTTACCTCGAGGTAAGTGACCAGGAACTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-425s21c1
Sequence:CCGCATTGTAGCAGCCAGCGGCTATCTCGAGATAGCCGCTGGCTGCTACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-770s21c1
Sequence:CCGGGAGACCTGGACCTCAGTTATGCTCGAGCATAACTGAGGTCCAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-923s21c1
Sequence:CCGGAGCGCTGTACAGCAGATTCTCCTCGAGGAGAATCTGCTGTACAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005210
LRRC55 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 55
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-559s1c1
Sequence:CCGGGATTTGCACAACAACTCCTTACTCGAGTAAGGAGTTGTTGTGCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005210.1-3175s1c1
Sequence:CCGGCCTGCTTTACAATGTGTAGATCTCGAGATCTACACATTGTAAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-525s1c1
Sequence:CCGGCTACCTCACATGCTACATGGACTCGAGTCCATGTAGCATGTGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-204s1c1
Sequence:CCGGGTCACAGACTCTCGATTCCATCTCGAGATGGAATCGAGAGTCTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-200s1c1
Sequence:CCGGCTGTGTCACAGACTCTCGATTCTCGAGAATCGAGAGTCTGTGACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-1151s1c1
Sequence:CCGGCCAGTGAAGAGGAAGAGATCTCTCGAGAGATCTCTTCCTCTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-393s1c1
Sequence:CCGGCGTCCTTTGCACATGCCGTAACTCGAGTTACGGCATGTGCAAAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-1038s1c1
Sequence:CCGGCCTGGATGATTACCTATTCATCTCGAGATGAATAGGTAATCATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005210.2-1649s21c1
Sequence:CCGGGAACAGTTCCTGGTCACTTACCTCGAGGTAAGTGACCAGGAACTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-425s21c1
Sequence:CCGCATTGTAGCAGCCAGCGGCTATCTCGAGATAGCCGCTGGCTGCTACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-770s21c1
Sequence:CCGGGAGACCTGGACCTCAGTTATGCTCGAGCATAACTGAGGTCCAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-923s21c1
Sequence:CCGGAGCGCTGTACAGCAGATTCTCCTCGAGGAGAATCTGCTGTACAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005210
LRRC55 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 55
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-559s1c1
Sequence:CCGGGATTTGCACAACAACTCCTTACTCGAGTAAGGAGTTGTTGTGCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005210.1-3175s1c1
Sequence:CCGGCCTGCTTTACAATGTGTAGATCTCGAGATCTACACATTGTAAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-525s1c1
Sequence:CCGGCTACCTCACATGCTACATGGACTCGAGTCCATGTAGCATGTGAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-204s1c1
Sequence:CCGGGTCACAGACTCTCGATTCCATCTCGAGATGGAATCGAGAGTCTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-200s1c1
Sequence:CCGGCTGTGTCACAGACTCTCGATTCTCGAGAATCGAGAGTCTGTGACACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005210.1-1151s1c1
Sequence:CCGGCCAGTGAAGAGGAAGAGATCTCTCGAGAGATCTCTTCCTCTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-393s1c1
Sequence:CCGGCGTCCTTTGCACATGCCGTAACTCGAGTTACGGCATGTGCAAAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005210.1-1038s1c1
Sequence:CCGGCCTGGATGATTACCTATTCATCTCGAGATGAATAGGTAATCATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005210.2-1649s21c1
Sequence:CCGGGAACAGTTCCTGGTCACTTACCTCGAGGTAAGTGACCAGGAACTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-425s21c1
Sequence:CCGCATTGTAGCAGCCAGCGGCTATCTCGAGATAGCCGCTGGCTGCTACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-770s21c1
Sequence:CCGGGAGACCTGGACCTCAGTTATGCTCGAGCATAACTGAGGTCCAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005210.2-923s21c1
Sequence:CCGGAGCGCTGTACAGCAGATTCTCCTCGAGGAGAATCTGCTGTACAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033346
LRRC55 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 55
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-919s21c1
Sequence:CCGGCACCGTTGGAGCAAGGCTAATCTCGAGATTAGCCTTGCTCCAACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-949s21c1
Sequence:CCGGGAGATTTGACACAGATCTTTGCTCGAGCAAAGATCTGTGTCAAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-465s21c1
Sequence:CCGGAGCTCATGGACTGGTACATATCTCGAGATATGTACCAGTCCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033346.2-1827s21c1
Sequence:CCGGTGTCTCGAAATAGTCTAATAACTCGAGTTATTAGACTATTTCGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-813s21c1
Sequence:CCGGGACTCTGACCCTGGATGATTACTCGAGTAATCATCCAGGGTCAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033346
LRRC55 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 55
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-919s21c1
Sequence:CCGGCACCGTTGGAGCAAGGCTAATCTCGAGATTAGCCTTGCTCCAACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-949s21c1
Sequence:CCGGGAGATTTGACACAGATCTTTGCTCGAGCAAAGATCTGTGTCAAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-465s21c1
Sequence:CCGGAGCTCATGGACTGGTACATATCTCGAGATATGTACCAGTCCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033346.2-1827s21c1
Sequence:CCGGTGTCTCGAAATAGTCTAATAACTCGAGTTATTAGACTATTTCGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-813s21c1
Sequence:CCGGGACTCTGACCCTGGATGATTACTCGAGTAATCATCCAGGGTCAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033346
LRRC55 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 55
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-919s21c1
Sequence:CCGGCACCGTTGGAGCAAGGCTAATCTCGAGATTAGCCTTGCTCCAACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-949s21c1
Sequence:CCGGGAGATTTGACACAGATCTTTGCTCGAGCAAAGATCTGTGTCAAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-465s21c1
Sequence:CCGGAGCTCATGGACTGGTACATATCTCGAGATATGTACCAGTCCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033346.2-1827s21c1
Sequence:CCGGTGTCTCGAAATAGTCTAATAACTCGAGTTATTAGACTATTTCGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033346.2-813s21c1
Sequence:CCGGGACTCTGACCCTGGATGATTACTCGAGTAATCATCCAGGGTCAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)