EMAIL THIS PAGE TO A FRIEND

LRRC56

leucine rich repeat containing 56

44 Gene Product Result for
UniProtKB ID: Q8IYG6, Q8N3Q4
Gene ID:
Mouse(70552) leucine rich repeat containing 56
Rat(365389) leucine rich repeat containing 56
sheep(101104106) leucine rich repeat containing 56
naked mole-rat(101715718) leucine rich repeat containing 56
domestic guinea pig(100734757) leucine rich repeat containing 56
domestic cat(101085074) leucine rich repeat containing 56
cow(100851894) leucine rich repeat containing 56
Horse(100055563) leucine rich repeat containing 56
dog(483404) leucine rich repeat containing 56
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_352003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_352003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_352003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU039601 MISSION® esiRNA esiRNA targeting mouse Lrrc56 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198075 Rosetta Predictions human pricing
NM_001024902 Rosetta Predictions rat pricing
NM_153777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093338 predicted 883
2 SASI_Hs01_00093339 predicted 1851
3 SASI_Hs01_00093340 predicted 914
4 SASI_Hs01_00093341 predicted 1447
5 SASI_Hs02_00371624 predicted 1614
6 SASI_Hs01_00093344 predicted 904
7 SASI_Hs02_00371625 predicted 759
8 SASI_Hs01_00093345 predicted 1067
9 SASI_Hs01_00093346 predicted 2160
10 SASI_Hs01_00093347 predicted 713
11 SASI_Hs01_00093342 predicted 1409
12 SASI_Hs01_00093343 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059915 predicted 1395
2 SASI_Rn01_00059916 predicted 1181
3 SASI_Rn01_00059917 predicted 1356
4 SASI_Rn01_00059918 predicted 1790
5 SASI_Rn01_00059919 predicted 1899
6 SASI_Rn01_00059920 predicted 1159
7 SASI_Rn01_00059921 predicted 208
8 SASI_Rn01_00059922 predicted 424
9 SASI_Rn01_00059923 predicted 451
10 SASI_Rn01_00059924 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107982 predicted 1155
2 SASI_Mm01_00107983 predicted 585
3 SASI_Mm01_00107984 predicted 1800
4 SASI_Mm01_00107985 predicted 428
5 SASI_Mm01_00107986 predicted 1921
6 SASI_Mm01_00107987 predicted 207
7 SASI_Mm01_00107988 predicted 668
8 SASI_Mm01_00107989 predicted 437
9 SASI_Mm01_00107990 predicted 453
10 SASI_Mm01_00107991 predicted 1888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198075
LRRC56 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 56
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198075.2-2429s21c1
Sequence:CCGGAGGCCTCTCCTGCTAGAATTGCTCGAGCAATTCTAGCAGGAGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-1139s21c1
Sequence:CCGGCAGAGGTGAGGAAGCTCATTCCTCGAGGAATGAGCTTCCTCACCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-954s21c1
Sequence:CCGGACTGTGCCTGCTGGAACAATTCTCGAGAATTGTTCCAGCAGGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-915s21c1
Sequence:CCGGACTCTACGCCTCCTACAACAACTCGAGTTGTTGTAGGAGGCGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-889s21c1
Sequence:CCGGATCGCCTCTTTGCCAGCACTTCTCGAGAAGTGCTGGCAAAGAGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198075
LRRC56 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 56
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198075.2-2429s21c1
Sequence:CCGGAGGCCTCTCCTGCTAGAATTGCTCGAGCAATTCTAGCAGGAGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-1139s21c1
Sequence:CCGGCAGAGGTGAGGAAGCTCATTCCTCGAGGAATGAGCTTCCTCACCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-954s21c1
Sequence:CCGGACTGTGCCTGCTGGAACAATTCTCGAGAATTGTTCCAGCAGGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-915s21c1
Sequence:CCGGACTCTACGCCTCCTACAACAACTCGAGTTGTTGTAGGAGGCGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-889s21c1
Sequence:CCGGATCGCCTCTTTGCCAGCACTTCTCGAGAAGTGCTGGCAAAGAGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198075
LRRC56 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 56
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198075.2-2429s21c1
Sequence:CCGGAGGCCTCTCCTGCTAGAATTGCTCGAGCAATTCTAGCAGGAGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-1139s21c1
Sequence:CCGGCAGAGGTGAGGAAGCTCATTCCTCGAGGAATGAGCTTCCTCACCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-954s21c1
Sequence:CCGGACTGTGCCTGCTGGAACAATTCTCGAGAATTGTTCCAGCAGGCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-915s21c1
Sequence:CCGGACTCTACGCCTCCTACAACAACTCGAGTTGTTGTAGGAGGCGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198075.2-889s21c1
Sequence:CCGGATCGCCTCTTTGCCAGCACTTCTCGAGAAGTGCTGGCAAAGAGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_352003
LRRC56 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 56
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-1443s1c1
Sequence:CCGGCTACGCCTCCTACAACAACATCTCGAGATGTTGTTGTAGGAGGCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-1425s1c1
Sequence:CCGGGCCAGCACTTAAGGAACTCTACTCGAGTAGAGTTCCTTAAGTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-27s1c1
Sequence:CCGGCTTCGACAAATATTTGAGCATCTCGAGATGCTCAAATATTTGTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_352003
LRRC56 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 56
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-1443s1c1
Sequence:CCGGCTACGCCTCCTACAACAACATCTCGAGATGTTGTTGTAGGAGGCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-1425s1c1
Sequence:CCGGGCCAGCACTTAAGGAACTCTACTCGAGTAGAGTTCCTTAAGTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-27s1c1
Sequence:CCGGCTTCGACAAATATTTGAGCATCTCGAGATGCTCAAATATTTGTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_352003
LRRC56 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 56
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-1443s1c1
Sequence:CCGGCTACGCCTCCTACAACAACATCTCGAGATGTTGTTGTAGGAGGCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-1425s1c1
Sequence:CCGGGCCAGCACTTAAGGAACTCTACTCGAGTAGAGTTCCTTAAGTGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_352003.1-27s1c1
Sequence:CCGGCTTCGACAAATATTTGAGCATCTCGAGATGCTCAAATATTTGTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153777
LRRC56 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 56
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000109616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-427s1c1
Sequence:CCGGCTTCGGATTGTACCTCCCTAACTCGAGTTAGGGAGGTACAATCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-1174s1c1
Sequence:CCGGCCTTCGGAAACGTAGAAACCACTCGAGTGGTTTCTACGTTTCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-548s1c1
Sequence:CCGGCTGACTGACTTGGATGGCATTCTCGAGAATGCCATCCAAGTCAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-1184s1c1
Sequence:CCGGCGTAGAAACCAGTACCAGGAACTCGAGTTCCTGGTACTGGTTTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153777
LRRC56 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 56
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000109616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-427s1c1
Sequence:CCGGCTTCGGATTGTACCTCCCTAACTCGAGTTAGGGAGGTACAATCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-1174s1c1
Sequence:CCGGCCTTCGGAAACGTAGAAACCACTCGAGTGGTTTCTACGTTTCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-548s1c1
Sequence:CCGGCTGACTGACTTGGATGGCATTCTCGAGAATGCCATCCAAGTCAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-1184s1c1
Sequence:CCGGCGTAGAAACCAGTACCAGGAACTCGAGTTCCTGGTACTGGTTTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153777
LRRC56 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 56
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000109616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-427s1c1
Sequence:CCGGCTTCGGATTGTACCTCCCTAACTCGAGTTAGGGAGGTACAATCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-1174s1c1
Sequence:CCGGCCTTCGGAAACGTAGAAACCACTCGAGTGGTTTCTACGTTTCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-548s1c1
Sequence:CCGGCTGACTGACTTGGATGGCATTCTCGAGAATGCCATCCAAGTCAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153777.1-1184s1c1
Sequence:CCGGCGTAGAAACCAGTACCAGGAACTCGAGTTCCTGGTACTGGTTTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)