EMAIL THIS PAGE TO A FRIEND

LRRC57

leucine rich repeat containing 57

107 Gene Product Result for
UniProtKB ID: Q8N9N7, Q7Z2Z6, Q8N1T6
Gene ID:
Mouse(66606) leucine rich repeat containing 57
Rat(311346) leucine rich repeat containing 57
Zebrafish(436900) leucine rich repeat containing 57
cow(508699) leucine rich repeat containing 57
domestic cat(101101061) leucine rich repeat containing 57
dog(478269) leucine rich repeat containing 57
chicken(423236) leucine rich repeat containing 57
domestic guinea pig(100712858) leucine rich repeat containing 57
naked mole-rat(101712449) leucine rich repeat containing 57
sheep(101118191) leucine rich repeat containing 57
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101392 Anti-LRRC57 antibody produced in rabbit affinity isolated antibody pig, horse, mouse, human, rat, dog
western blot pricing
HPA040894 Anti-LRRC57 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103222 Anti-LRRC57, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, rat, bovine, dog, human, horse, mouse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153260 Rosetta Predictions human pricing
NM_001012354 Rosetta Predictions rat pricing
NM_025657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232627 predicted 952
2 SASI_Hs01_00232628 predicted 578
3 SASI_Hs01_00232629 predicted 1079
4 SASI_Hs01_00232630 predicted 1034
5 SASI_Hs01_00232631 predicted 859
6 SASI_Hs01_00232632 predicted 1179
7 SASI_Hs01_00232633 predicted 637
8 SASI_Hs01_00232634 predicted 1110
9 SASI_Hs01_00232635 predicted 1150
10 SASI_Hs01_00232636 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095867 predicted 982
2 SASI_Rn01_00095868 predicted 535
3 SASI_Rn01_00095869 predicted 943
4 SASI_Rn02_00200534 predicted 874
5 SASI_Rn02_00200535 predicted 1088
6 SASI_Rn02_00200536 predicted 714
7 SASI_Rn01_00095871 predicted 544
8 SASI_Rn01_00095872 predicted 994
9 SASI_Rn01_00095873 predicted 1017
10 SASI_Rn02_00200537 predicted 777
11 SASI_Rn01_00095870 predicted 846
12 SASI_Rn01_00095874 predicted 844
13 SASI_Rn01_00095875 predicted 411
14 SASI_Rn01_00095876 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121312 predicted 321
2 SASI_Mm01_00121313 predicted 271
3 SASI_Mm01_00121314 predicted 810
4 SASI_Mm01_00121315 predicted 454
5 SASI_Mm01_00121316 predicted 770
6 SASI_Mm01_00121317 predicted 536
7 SASI_Mm01_00121318 predicted 210
8 SASI_Mm01_00121319 predicted 275
9 SASI_Mm01_00121320 predicted 761
10 SASI_Mm02_00328788 predicted 408
11 SASI_Mm01_00121311 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025657
VALIDATED
LRRC57 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 57
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000179028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-576s1c1
Sequence:CCGGCGAACTCAATCTCAACCAGAACTCGAGTTCTGGTTGAGATTGAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-733s1c1
Sequence:CCGGGAAGGCAATCTCTTTGAAATACTCGAGTATTTCAAAGAGATTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025657.2-234s1c1
Sequence:CCGGCATCGATTTATCCAACAACAACTCGAGTTGTTGTTGGATAAATCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-1319s1c1
Sequence:CCGGCCTTTGTCAAAGGAGCACCAACTCGAGTTGGTGCTCCTTTGACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025657
VALIDATED
LRRC57 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 57
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000179028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-576s1c1
Sequence:CCGGCGAACTCAATCTCAACCAGAACTCGAGTTCTGGTTGAGATTGAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-733s1c1
Sequence:CCGGGAAGGCAATCTCTTTGAAATACTCGAGTATTTCAAAGAGATTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025657.2-234s1c1
Sequence:CCGGCATCGATTTATCCAACAACAACTCGAGTTGTTGTTGGATAAATCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-1319s1c1
Sequence:CCGGCCTTTGTCAAAGGAGCACCAACTCGAGTTGGTGCTCCTTTGACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025657
VALIDATED
LRRC57 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 57
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000179028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-576s1c1
Sequence:CCGGCGAACTCAATCTCAACCAGAACTCGAGTTCTGGTTGAGATTGAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-733s1c1
Sequence:CCGGGAAGGCAATCTCTTTGAAATACTCGAGTATTTCAAAGAGATTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025657.2-234s1c1
Sequence:CCGGCATCGATTTATCCAACAACAACTCGAGTTGTTGTTGGATAAATCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025657.2-1319s1c1
Sequence:CCGGCCTTTGTCAAAGGAGCACCAACTCGAGTTGGTGCTCCTTTGACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153260
VALIDATED
LRRC57 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 57
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153260.2-651s21c1
Sequence:CCGGTCTTGCTGTCCACGCCTTAAACTCGAGTTTAAGGCGTGGACAGCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153260.2-553s21c1
Sequence:CCGGAGAACCAGATTCGAAGTATACCTCGAGGTATACTTCGAATCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-824s1c1
Sequence:CCGGGCTGCAAGTCATCGAACTCAACTCGAGTTGAGTTCGATGACTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-530s1c1
Sequence:CCGGGCCTTTGCTGATAGGAAAGTTCTCGAGAACTTTCCTATCAGCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-1020s1c1
Sequence:CCGGCTTCGAGAACTGGAAGGCTATCTCGAGATAGCCTTCCAGTTCTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153260.2-610s21c1
Sequence:CCGGACCTCAACCAGAATCAGATATCTCGAGATATCTGATTCTGGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153260.2-393s21c1
Sequence:CCGGCTAGAGACGCTAAGCCTAAACCTCGAGGTTTAGGCTTAGCGTCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153260.2-964s21c1
Sequence:CCGGTGATACTTCAGGAGATTATATCTCGAGATATAATCTCCTGAAGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153260
VALIDATED
LRRC57 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 57
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153260.2-651s21c1
Sequence:CCGGTCTTGCTGTCCACGCCTTAAACTCGAGTTTAAGGCGTGGACAGCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153260.2-553s21c1
Sequence:CCGGAGAACCAGATTCGAAGTATACCTCGAGGTATACTTCGAATCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-824s1c1
Sequence:CCGGGCTGCAAGTCATCGAACTCAACTCGAGTTGAGTTCGATGACTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-530s1c1
Sequence:CCGGGCCTTTGCTGATAGGAAAGTTCTCGAGAACTTTCCTATCAGCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-1020s1c1
Sequence:CCGGCTTCGAGAACTGGAAGGCTATCTCGAGATAGCCTTCCAGTTCTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153260.2-610s21c1
Sequence:CCGGACCTCAACCAGAATCAGATATCTCGAGATATCTGATTCTGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153260.2-393s21c1
Sequence:CCGGCTAGAGACGCTAAGCCTAAACCTCGAGGTTTAGGCTTAGCGTCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153260.2-964s21c1
Sequence:CCGGTGATACTTCAGGAGATTATATCTCGAGATATAATCTCCTGAAGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153260
VALIDATED
LRRC57 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 57
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153260.2-651s21c1
Sequence:CCGGTCTTGCTGTCCACGCCTTAAACTCGAGTTTAAGGCGTGGACAGCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153260.2-553s21c1
Sequence:CCGGAGAACCAGATTCGAAGTATACCTCGAGGTATACTTCGAATCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-824s1c1
Sequence:CCGGGCTGCAAGTCATCGAACTCAACTCGAGTTGAGTTCGATGACTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-530s1c1
Sequence:CCGGGCCTTTGCTGATAGGAAAGTTCTCGAGAACTTTCCTATCAGCAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153260.1-1020s1c1
Sequence:CCGGCTTCGAGAACTGGAAGGCTATCTCGAGATAGCCTTCCAGTTCTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_153260.2-610s21c1
Sequence:CCGGACCTCAACCAGAATCAGATATCTCGAGATATCTGATTCTGGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153260.2-393s21c1
Sequence:CCGGCTAGAGACGCTAAGCCTAAACCTCGAGGTTTAGGCTTAGCGTCTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153260.2-964s21c1
Sequence:CCGGTGATACTTCAGGAGATTATATCTCGAGATATAATCTCCTGAAGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)