EMAIL THIS PAGE TO A FRIEND

LRRC58

leucine rich repeat containing 58

142 Gene Product Result for
UniProtKB ID: Q96CX6
Gene ID:
Mouse(320184) leucine rich repeat containing 58
Rat(303919) leucine rich repeat containing 58
sheep(101108095) leucine rich repeat containing 58
naked mole-rat(101697903) leucine rich repeat containing 58
domestic guinea pig(100715130) leucine rich repeat containing 58
chicken(418332) leucine rich repeat containing 58
dog(488001) leucine rich repeat containing 58
domestic cat(101088608) leucine rich repeat containing 58
cow(535725) leucine rich repeat containing 58
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099678 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002341 MISSION® esiRNA esiRNA targeting human LRRC58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099678 Rosetta Predictions human pricing
XM_057296 Rosetta Predictions human pricing
XM_001069929 Rosetta Predictions rat pricing
XM_221433 Rosetta Predictions rat pricing
NM_177093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321028 predicted 898
2 SASI_Hs02_00321029 predicted 649
3 SASI_Hs02_00321030 predicted 1274
4 SASI_Hs02_00321031 predicted 661
5 SASI_Hs02_00321032 predicted 969
6 SASI_Hs02_00321033 predicted 990
7 SASI_Hs02_00321034 predicted 1300
8 SASI_Hs02_00321035 predicted 747
9 SASI_Hs02_00321036 predicted 786
10 SASI_Hs02_00321037 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_057296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273255 predicted 1447
2 SASI_Hs01_00273256 predicted 810
3 SASI_Hs01_00273257 predicted 1439
4 SASI_Hs01_00273258 predicted 825
5 SASI_Hs01_00273259 predicted 1137
6 SASI_Hs01_00273260 predicted 1153
7 SASI_Hs01_00273261 predicted 1472
8 SASI_Hs01_00273262 predicted 917
9 SASI_Hs01_00273263 predicted 1135
10 SASI_Hs01_00273264 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329836 predicted 839
2 SASI_Rn02_00329837 predicted 958
3 SASI_Rn02_00329838 predicted 974
4 SASI_Rn02_00329839 predicted 1004
5 SASI_Rn02_00329840 predicted 756
6 SASI_Rn02_00329841 predicted 881
7 SASI_Rn02_00329842 predicted 564
8 SASI_Rn02_00329843 predicted 1130
9 SASI_Rn02_00329844 predicted 1291
10 SASI_Rn02_00329845 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380125 predicted 712
2 SASI_Rn02_00380126 predicted 633
3 SASI_Rn02_00380127 predicted 635
4 SASI_Rn02_00380128 predicted 755
5 SASI_Rn02_00380129 predicted 742
6 SASI_Rn02_00380130 predicted 597
7 SASI_Rn02_00380131 predicted 759
8 SASI_Rn02_00380132 predicted 758
9 SASI_Rn02_00380133 predicted 730
10 SASI_Rn02_00380134 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347085 predicted 1132
2 SASI_Mm01_00138492 predicted 845
3 SASI_Mm02_00347086 predicted 898
4 SASI_Mm02_00347087 predicted 566
5 SASI_Mm02_00347088 predicted 925
6 SASI_Mm02_00347089 predicted 992
7 SASI_Mm01_00138493 predicted 886
8 SASI_Mm01_00138496 predicted 760
9 SASI_Mm01_00138498 predicted 1000
10 SASI_Mm02_00347090 predicted 1127
11 SASI_Mm01_00138490 predicted 777
12 SASI_Mm01_00138491 predicted 793
13 SASI_Mm01_00138494 predicted 768
14 SASI_Mm01_00138495 predicted 716
15 SASI_Mm01_00138497 predicted 945
16 SASI_Mm01_00138499 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177093
VALIDATED
LRRC58 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 58
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-766s21c1
Sequence:CCGGCGAGAGATCCTTAATCTTATTCTCGAGAATAAGATTAAGGATCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-1768s1c1
Sequence:CCGGGTGATATGTTATAGTGCCTTACTCGAGTAAGGCACTATAACATATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-747s1c1
Sequence:CCGGGCACAATAACTTGCTGACTTACTCGAGTAAGTCAGCAAGTTATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177093.2-894s1c1
Sequence:CCGGGACCATTAAGATCCGAAGTATCTCGAGATACTTCGGATCTTAATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-874s21c1
Sequence:CCGGTTAGCTGCAAGGACCATTAAGCTCGAGCTTAATGGTCCTTGCAGCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177093.3-1759s21c1
Sequence:CCGGGTGATATGTTATAGTGCCTTACTCGAGTAAGGCACTATAACATATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-775s1c1
Sequence:CCGGCGAGAGATCCTTAATCTTATTCTCGAGAATAAGATTAAGGATCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-565s21c1
Sequence:CCGGATCGAGAACTTGCGGAGTTTACTCGAGTAAACTCCGCAAGTTCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177093.2-1456s1c1
Sequence:CCGGCCATGTAAGTCTTTGAAGAAACTCGAGTTTCTTCAAAGACTTACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177093
VALIDATED
LRRC58 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 58
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-766s21c1
Sequence:CCGGCGAGAGATCCTTAATCTTATTCTCGAGAATAAGATTAAGGATCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-1768s1c1
Sequence:CCGGGTGATATGTTATAGTGCCTTACTCGAGTAAGGCACTATAACATATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-747s1c1
Sequence:CCGGGCACAATAACTTGCTGACTTACTCGAGTAAGTCAGCAAGTTATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177093.2-894s1c1
Sequence:CCGGGACCATTAAGATCCGAAGTATCTCGAGATACTTCGGATCTTAATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-874s21c1
Sequence:CCGGTTAGCTGCAAGGACCATTAAGCTCGAGCTTAATGGTCCTTGCAGCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177093.3-1759s21c1
Sequence:CCGGGTGATATGTTATAGTGCCTTACTCGAGTAAGGCACTATAACATATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-775s1c1
Sequence:CCGGCGAGAGATCCTTAATCTTATTCTCGAGAATAAGATTAAGGATCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-565s21c1
Sequence:CCGGATCGAGAACTTGCGGAGTTTACTCGAGTAAACTCCGCAAGTTCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177093.2-1456s1c1
Sequence:CCGGCCATGTAAGTCTTTGAAGAAACTCGAGTTTCTTCAAAGACTTACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177093
VALIDATED
LRRC58 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 58
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-766s21c1
Sequence:CCGGCGAGAGATCCTTAATCTTATTCTCGAGAATAAGATTAAGGATCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-1768s1c1
Sequence:CCGGGTGATATGTTATAGTGCCTTACTCGAGTAAGGCACTATAACATATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-747s1c1
Sequence:CCGGGCACAATAACTTGCTGACTTACTCGAGTAAGTCAGCAAGTTATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177093.2-894s1c1
Sequence:CCGGGACCATTAAGATCCGAAGTATCTCGAGATACTTCGGATCTTAATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-874s21c1
Sequence:CCGGTTAGCTGCAAGGACCATTAAGCTCGAGCTTAATGGTCCTTGCAGCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339304    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177093.3-1759s21c1
Sequence:CCGGGTGATATGTTATAGTGCCTTACTCGAGTAAGGCACTATAACATATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177093.2-775s1c1
Sequence:CCGGCGAGAGATCCTTAATCTTATTCTCGAGAATAAGATTAAGGATCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177093.3-565s21c1
Sequence:CCGGATCGAGAACTTGCGGAGTTTACTCGAGTAAACTCCGCAAGTTCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177093.2-1456s1c1
Sequence:CCGGCCATGTAAGTCTTTGAAGAAACTCGAGTTTCTTCAAAGACTTACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099678
VALIDATED
LRRC58 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 58
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-900s21c1
Sequence:CCGGGACCATTAAGATTCGAAATATCTCGAGATATTTCGAATCTTAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099678.1-4411s21c1
Sequence:CCGGGCCGAAGTGGATGGATCATATCTCGAGATATGATCCATCCACTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099678.1-780s21c1
Sequence:CCGGTCGAGAGATCCTCAACCTTATCTCGAGATAAGGTTGAGGATCTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-811s21c1
Sequence:CCGGGAGTTGAGTTTACGAGGAAATCTCGAGATTTCCTCGTAAACTCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-1171s21c1
Sequence:CCGGAGTGTTGCTGCACGCAGAATGCTCGAGCATTCTGCGTGCAGCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099678
VALIDATED
LRRC58 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 58
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-900s21c1
Sequence:CCGGGACCATTAAGATTCGAAATATCTCGAGATATTTCGAATCTTAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099678.1-4411s21c1
Sequence:CCGGGCCGAAGTGGATGGATCATATCTCGAGATATGATCCATCCACTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099678.1-780s21c1
Sequence:CCGGTCGAGAGATCCTCAACCTTATCTCGAGATAAGGTTGAGGATCTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-811s21c1
Sequence:CCGGGAGTTGAGTTTACGAGGAAATCTCGAGATTTCCTCGTAAACTCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-1171s21c1
Sequence:CCGGAGTGTTGCTGCACGCAGAATGCTCGAGCATTCTGCGTGCAGCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099678
VALIDATED
LRRC58 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 58
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-900s21c1
Sequence:CCGGGACCATTAAGATTCGAAATATCTCGAGATATTTCGAATCTTAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099678.1-4411s21c1
Sequence:CCGGGCCGAAGTGGATGGATCATATCTCGAGATATGATCCATCCACTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001099678.1-780s21c1
Sequence:CCGGTCGAGAGATCCTCAACCTTATCTCGAGATAAGGTTGAGGATCTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-811s21c1
Sequence:CCGGGAGTTGAGTTTACGAGGAAATCTCGAGATTTCCTCGTAAACTCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099678.1-1171s21c1
Sequence:CCGGAGTGTTGCTGCACGCAGAATGCTCGAGCATTCTGCGTGCAGCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)