EMAIL THIS PAGE TO A FRIEND

LRRC59

leucine rich repeat containing 59

122 Gene Product Result for
Synonyms: p34
UniProtKB ID: Q96AG4, B2RE83, D3DTX8, Q9P189
Gene ID:
Mouse(98238) leucine rich repeat containing 59
Rat(287633) leucine rich repeat containing 59
Zebrafish(405868) leucine rich repeat containing 59
chicken(422103) leucine rich repeat containing 59
cow(532659) leucine rich repeat containing 59
domestic cat(101090911) leucine rich repeat containing 59
dog(491080) leucine rich repeat containing 59
domestic guinea pig(100732192) leucine rich repeat containing 59
naked mole-rat(101704624) leucine rich repeat containing 59
sheep(101106343) leucine rich repeat containing 59
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV49323 Anti-LRRC59 antibody produced in rabbit affinity isolated antibody rat, human, mouse, rabbit, dog, pig
immunohistochemistry, western blot pricing
SAB2101393 Anti-LRRC59 antibody produced in rabbit affinity isolated antibody human, rat, mouse, guinea pig, dog, bovine
immunohistochemistry, western blot pricing
HPA030827 Anti-LRRC59 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA030829 Anti-LRRC59 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018509 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018509 Rosetta Predictions human pricing
NM_001008280 Rosetta Predictions rat pricing
NM_133807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234716 predicted 442
2 SASI_Hs01_00234717 predicted 535
3 SASI_Hs01_00234718 predicted 552
4 SASI_Hs01_00234719 predicted 571
5 SASI_Hs01_00234720 predicted 274
6 SASI_Hs01_00234721 predicted 560
7 SASI_Hs01_00234722 predicted 278
8 SASI_Hs01_00234723 predicted 659
9 SASI_Hs01_00234724 predicted 331
10 SASI_Hs02_00352091 predicted 341
11 SASI_Hs01_00234725 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092117 predicted 611
2 SASI_Rn01_00092118 predicted 451
3 SASI_Rn02_00198979 predicted 629
4 SASI_Rn01_00092119 predicted 1178
5 SASI_Rn01_00092121 predicted 1342
6 SASI_Rn01_00092122 predicted 1423
7 SASI_Rn01_00092123 predicted 350
8 SASI_Rn01_00092124 predicted 330
9 SASI_Rn01_00092125 predicted 608
10 SASI_Rn01_00092126 predicted 1380
11 SASI_Rn01_00092120 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338833 predicted 559
2 SASI_Mm01_00108654 predicted 413
3 SASI_Mm01_00108655 predicted 298
4 SASI_Mm02_00338834 predicted 1046
5 SASI_Mm01_00108657 predicted 429
6 SASI_Mm02_00338835 predicted 445
7 SASI_Mm01_00108659 predicted 1011
8 SASI_Mm01_00108661 predicted 1307
9 SASI_Mm01_00108662 predicted 333
10 SASI_Mm01_00108663 predicted 1323
11 SASI_Mm01_00108656 predicted 599
12 SASI_Mm01_00108658 predicted 1155
13 SASI_Mm01_00108660 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018509
VALIDATED
LRRC59 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 59
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018509.2-746s1c1
Sequence:CCGGCGCCGGAGAAAGGAGTATGATCTCGAGATCATACTCCTTTCTCCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-283s1c1
Sequence:CCGGCCTGGATCTGTCTTGTAATAACTCGAGTTATTACAAGACAGATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-1516s1c1
Sequence:CCGGGCTCAGTAAATCCAGTCTAAACTCGAGTTTAGACTGGATTTACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-559s1c1
Sequence:CCGGGCAGTGTAAGCAGTGTGCAAACTCGAGTTTGCACACTGCTTACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-1391s21c1
Sequence:CCGGCAAGGCTCGTTTCTACTAAATCTCGAGATTTAGTAGAAACGAGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-283s21c1
Sequence:CCGGCCTGGATCTGTCTTGTAATAACTCGAGTTATTACAAGACAGATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-307s21c1
Sequence:CCGGGACTACTCTACCGTCGGATTTCTCGAGAAATCCGACGGTAGAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-746s21c1
Sequence:CCGGCGCCGGAGAAAGGAGTATGATCTCGAGATCATACTCCTTTCTCCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-559s21c1
Sequence:CCGGGCAGTGTAAGCAGTGTGCAAACTCGAGTTTGCACACTGCTTACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018509
VALIDATED
LRRC59 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 59
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018509.2-746s1c1
Sequence:CCGGCGCCGGAGAAAGGAGTATGATCTCGAGATCATACTCCTTTCTCCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-283s1c1
Sequence:CCGGCCTGGATCTGTCTTGTAATAACTCGAGTTATTACAAGACAGATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-1516s1c1
Sequence:CCGGGCTCAGTAAATCCAGTCTAAACTCGAGTTTAGACTGGATTTACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-559s1c1
Sequence:CCGGGCAGTGTAAGCAGTGTGCAAACTCGAGTTTGCACACTGCTTACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-1391s21c1
Sequence:CCGGCAAGGCTCGTTTCTACTAAATCTCGAGATTTAGTAGAAACGAGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-283s21c1
Sequence:CCGGCCTGGATCTGTCTTGTAATAACTCGAGTTATTACAAGACAGATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-307s21c1
Sequence:CCGGGACTACTCTACCGTCGGATTTCTCGAGAAATCCGACGGTAGAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-746s21c1
Sequence:CCGGCGCCGGAGAAAGGAGTATGATCTCGAGATCATACTCCTTTCTCCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-559s21c1
Sequence:CCGGGCAGTGTAAGCAGTGTGCAAACTCGAGTTTGCACACTGCTTACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018509
VALIDATED
LRRC59 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 59
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018509.2-746s1c1
Sequence:CCGGCGCCGGAGAAAGGAGTATGATCTCGAGATCATACTCCTTTCTCCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-283s1c1
Sequence:CCGGCCTGGATCTGTCTTGTAATAACTCGAGTTATTACAAGACAGATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-1516s1c1
Sequence:CCGGGCTCAGTAAATCCAGTCTAAACTCGAGTTTAGACTGGATTTACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018509.2-559s1c1
Sequence:CCGGGCAGTGTAAGCAGTGTGCAAACTCGAGTTTGCACACTGCTTACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-1391s21c1
Sequence:CCGGCAAGGCTCGTTTCTACTAAATCTCGAGATTTAGTAGAAACGAGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-283s21c1
Sequence:CCGGCCTGGATCTGTCTTGTAATAACTCGAGTTATTACAAGACAGATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-307s21c1
Sequence:CCGGGACTACTCTACCGTCGGATTTCTCGAGAAATCCGACGGTAGAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-746s21c1
Sequence:CCGGCGCCGGAGAAAGGAGTATGATCTCGAGATCATACTCCTTTCTCCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018509.2-559s21c1
Sequence:CCGGGCAGTGTAAGCAGTGTGCAAACTCGAGTTTGCACACTGCTTACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133807
VALIDATED
LRRC59 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 59
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133807.1-2181s1c1
Sequence:CCGGGCAGAGTGATACATAACTAAACTCGAGTTTAGTTATGTATCACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-569s1c1
Sequence:CCGGGATTGCTTGGATGAGAAGCAACTCGAGTTGCTTCTCATCCAAGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133807.1-1018s1c1
Sequence:CCGGCGTGAACACCATCTACGACAACTCGAGTTGTCGTAGATGGTGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-429s1c1
Sequence:CCGGGCCTGGTTAACCTTCAGCATTCTCGAGAATGCTGAAGGTTAACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-595s1c1
Sequence:CCGGGCAGTGTGCAAACAAGGTGTTCTCGAGAACACCTTGTTTGCACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133807.1-2181s21c1
Sequence:CCGGGCAGAGTGATACATAACTAAACTCGAGTTTAGTTATGTATCACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-1018s21c1
Sequence:CCGGCGTGAACACCATCTACGACAACTCGAGTTGTCGTAGATGGTGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-429s21c1
Sequence:CCGGGCCTGGTTAACCTTCAGCATTCTCGAGAATGCTGAAGGTTAACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-595s21c1
Sequence:CCGGGCAGTGTGCAAACAAGGTGTTCTCGAGAACACCTTGTTTGCACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133807
VALIDATED
LRRC59 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 59
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133807.1-2181s1c1
Sequence:CCGGGCAGAGTGATACATAACTAAACTCGAGTTTAGTTATGTATCACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-569s1c1
Sequence:CCGGGATTGCTTGGATGAGAAGCAACTCGAGTTGCTTCTCATCCAAGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133807.1-1018s1c1
Sequence:CCGGCGTGAACACCATCTACGACAACTCGAGTTGTCGTAGATGGTGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-429s1c1
Sequence:CCGGGCCTGGTTAACCTTCAGCATTCTCGAGAATGCTGAAGGTTAACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-595s1c1
Sequence:CCGGGCAGTGTGCAAACAAGGTGTTCTCGAGAACACCTTGTTTGCACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133807.1-2181s21c1
Sequence:CCGGGCAGAGTGATACATAACTAAACTCGAGTTTAGTTATGTATCACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-1018s21c1
Sequence:CCGGCGTGAACACCATCTACGACAACTCGAGTTGTCGTAGATGGTGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-429s21c1
Sequence:CCGGGCCTGGTTAACCTTCAGCATTCTCGAGAATGCTGAAGGTTAACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-595s21c1
Sequence:CCGGGCAGTGTGCAAACAAGGTGTTCTCGAGAACACCTTGTTTGCACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133807
VALIDATED
LRRC59 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 59
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133807.1-2181s1c1
Sequence:CCGGGCAGAGTGATACATAACTAAACTCGAGTTTAGTTATGTATCACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-569s1c1
Sequence:CCGGGATTGCTTGGATGAGAAGCAACTCGAGTTGCTTCTCATCCAAGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133807.1-1018s1c1
Sequence:CCGGCGTGAACACCATCTACGACAACTCGAGTTGTCGTAGATGGTGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-429s1c1
Sequence:CCGGGCCTGGTTAACCTTCAGCATTCTCGAGAATGCTGAAGGTTAACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133807.1-595s1c1
Sequence:CCGGGCAGTGTGCAAACAAGGTGTTCTCGAGAACACCTTGTTTGCACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133807.1-2181s21c1
Sequence:CCGGGCAGAGTGATACATAACTAAACTCGAGTTTAGTTATGTATCACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-1018s21c1
Sequence:CCGGCGTGAACACCATCTACGACAACTCGAGTTGTCGTAGATGGTGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-429s21c1
Sequence:CCGGGCCTGGTTAACCTTCAGCATTCTCGAGAATGCTGAAGGTTAACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133807.1-595s21c1
Sequence:CCGGGCAGTGTGCAAACAAGGTGTTCTCGAGAACACCTTGTTTGCACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)