EMAIL THIS PAGE TO A FRIEND

LRRC61

leucine rich repeat containing 61

60 Gene Product Result for
Synonyms: HSPC295
UniProtKB ID: Q9BV99, B3KUW0, D3DWY8
Gene ID:
Mouse(243371) leucine rich repeat containing 61
Rat(500111) leucine rich repeat containing 61
Zebrafish(553439) leucine rich repeat containing 61
chicken(428394) leucine rich repeat containing 61
domestic cat(101091183) leucine rich repeat containing 61
cow(616659) leucine rich repeat containing 61
domestic guinea pig(100733126) leucine rich repeat containing 61
naked mole-rat(101724146) leucine rich repeat containing 61
sheep(101122271) leucine rich repeat containing 61
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023942 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023942 Rosetta Predictions human pricing
NM_001109231 Rosetta Predictions rat pricing
NM_001110160 Rosetta Predictions mouse pricing
NM_177736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018805 predicted 412
2 SASI_Hs01_00018806 predicted 1089
3 SASI_Hs01_00018808 predicted 490
4 SASI_Hs01_00018809 predicted 684
5 SASI_Hs02_00356415 predicted 1157
6 SASI_Hs01_00018810 predicted 477
7 SASI_Hs01_00018811 predicted 583
8 SASI_Hs01_00018812 predicted 1045
9 SASI_Hs01_00018813 predicted 409
10 SASI_Hs02_00356416 predicted 502
11 SASI_Hs01_00018807 predicted 1081
12 SASI_Hs01_00018814 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246374 predicted 805
2 SASI_Rn02_00246375 predicted 1103
3 SASI_Rn02_00246376 predicted 503
4 SASI_Rn02_00246377 predicted 498
5 SASI_Rn02_00246378 predicted 1292
6 SASI_Rn02_00246379 predicted 748
7 SASI_Rn02_00246380 predicted 1349
8 SASI_Rn02_00246381 predicted 1376
9 SASI_Rn02_00246382 predicted 1247
10 SASI_Rn02_00246383 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304796 predicted 653
2 SASI_Mm02_00304797 predicted 359
3 SASI_Mm02_00304798 predicted 433
4 SASI_Mm02_00304799 predicted 709
5 SASI_Mm02_00304800 predicted 433
6 SASI_Mm02_00304801 predicted 470
7 SASI_Mm02_00304802 predicted 367
8 SASI_Mm02_00304803 predicted 635
9 SASI_Mm02_00304804 predicted 589
10 SASI_Mm02_00304805 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157017 predicted 885
2 SASI_Mm01_00157019 predicted 657
3 SASI_Mm02_00348097 predicted 707
4 SASI_Mm01_00157020 predicted 931
5 SASI_Mm01_00157022 predicted 700
6 SASI_Mm01_00157023 predicted 595
7 SASI_Mm02_00348098 predicted 857
8 SASI_Mm01_00157024 predicted 823
9 SASI_Mm02_00348099 predicted 1118
10 SASI_Mm02_00348100 predicted 1409
11 SASI_Mm01_00157018 predicted 438
12 SASI_Mm01_00157021 predicted 519
13 SASI_Mm01_00157025 predicted 686
14 SASI_Mm01_00157026 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177736
VALIDATED
LRRC61 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 61
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177736.2-448s1c1
Sequence:CCGGTGGCTTGACCTATCAGGCAATCTCGAGATTGCCTGATAGGTCAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-722s21c1
Sequence:CCGGAGAACCTGCAGAGCCTCAATGCTCGAGCATTGAGGCTCTGCAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177736.2-1429s1c1
Sequence:CCGGCCACCTGCTTACTCTTATGAACTCGAGTTCATAAGAGTAAGCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177736.2-785s1c1
Sequence:CCGGGCAGTGAGCTGTACCAGTTATCTCGAGATAACTGGTACAGCTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177736.2-353s1c1
Sequence:CCGGCAGGAGAATTTGCCCTGGATTCTCGAGAATCCAGGGCAAATTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-667s21c1
Sequence:CCGGGTGCTCAACGTCTCCAATAATCTCGAGATTATTGGAGACGTTGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177736.3-1205s21c1
Sequence:CCGGTCTTCTGAATGCAACTCATAGCTCGAGCTATGAGTTGCATTCAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-841s21c1
Sequence:CCGGAGCAACCCGCTCTGTGCAAATCTCGAGATTTGCACAGAGCGGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-939s21c1
Sequence:CCGGCAGTGAGCTGTACCAGTTATGCTCGAGCATAACTGGTACAGCTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-1647s21c1
Sequence:CCGGATAGTCCAGTGCTCATATTATCTCGAGATAATATGAGCACTGGACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-1505s21c1
Sequence:CCGGAGAGGAGATCCCGTCACTATCCTCGAGGATAGTGACGGGATCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-891s21c1
Sequence:CCGGACTGCCTGGCCTCAAAGTCATCTCGAGATGACTTTGAGGCCAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177736
VALIDATED
LRRC61 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 61
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177736.2-448s1c1
Sequence:CCGGTGGCTTGACCTATCAGGCAATCTCGAGATTGCCTGATAGGTCAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-722s21c1
Sequence:CCGGAGAACCTGCAGAGCCTCAATGCTCGAGCATTGAGGCTCTGCAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177736.2-1429s1c1
Sequence:CCGGCCACCTGCTTACTCTTATGAACTCGAGTTCATAAGAGTAAGCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177736.2-785s1c1
Sequence:CCGGGCAGTGAGCTGTACCAGTTATCTCGAGATAACTGGTACAGCTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177736.2-353s1c1
Sequence:CCGGCAGGAGAATTTGCCCTGGATTCTCGAGAATCCAGGGCAAATTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-667s21c1
Sequence:CCGGGTGCTCAACGTCTCCAATAATCTCGAGATTATTGGAGACGTTGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177736.3-1205s21c1
Sequence:CCGGTCTTCTGAATGCAACTCATAGCTCGAGCTATGAGTTGCATTCAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-841s21c1
Sequence:CCGGAGCAACCCGCTCTGTGCAAATCTCGAGATTTGCACAGAGCGGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-939s21c1
Sequence:CCGGCAGTGAGCTGTACCAGTTATGCTCGAGCATAACTGGTACAGCTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-1647s21c1
Sequence:CCGGATAGTCCAGTGCTCATATTATCTCGAGATAATATGAGCACTGGACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-1505s21c1
Sequence:CCGGAGAGGAGATCCCGTCACTATCCTCGAGGATAGTGACGGGATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-891s21c1
Sequence:CCGGACTGCCTGGCCTCAAAGTCATCTCGAGATGACTTTGAGGCCAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177736
VALIDATED
LRRC61 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 61
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177736.2-448s1c1
Sequence:CCGGTGGCTTGACCTATCAGGCAATCTCGAGATTGCCTGATAGGTCAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-722s21c1
Sequence:CCGGAGAACCTGCAGAGCCTCAATGCTCGAGCATTGAGGCTCTGCAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177736.2-1429s1c1
Sequence:CCGGCCACCTGCTTACTCTTATGAACTCGAGTTCATAAGAGTAAGCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177736.2-785s1c1
Sequence:CCGGGCAGTGAGCTGTACCAGTTATCTCGAGATAACTGGTACAGCTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177736.2-353s1c1
Sequence:CCGGCAGGAGAATTTGCCCTGGATTCTCGAGAATCCAGGGCAAATTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-667s21c1
Sequence:CCGGGTGCTCAACGTCTCCAATAATCTCGAGATTATTGGAGACGTTGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177736.3-1205s21c1
Sequence:CCGGTCTTCTGAATGCAACTCATAGCTCGAGCTATGAGTTGCATTCAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-841s21c1
Sequence:CCGGAGCAACCCGCTCTGTGCAAATCTCGAGATTTGCACAGAGCGGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-939s21c1
Sequence:CCGGCAGTGAGCTGTACCAGTTATGCTCGAGCATAACTGGTACAGCTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-1647s21c1
Sequence:CCGGATAGTCCAGTGCTCATATTATCTCGAGATAATATGAGCACTGGACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-1505s21c1
Sequence:CCGGAGAGGAGATCCCGTCACTATCCTCGAGGATAGTGACGGGATCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177736.3-891s21c1
Sequence:CCGGACTGCCTGGCCTCAAAGTCATCTCGAGATGACTTTGAGGCCAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023942
LRRC61 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 61
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023942.1-703s1c1
Sequence:CCGGGTAGTGAGTTCTACCAGCTGTCTCGAGACAGCTGGTAGAACTCACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-1270s21c1
Sequence:CCGGGTCTTCTGAACGTGGCCTATGCTCGAGCATAGGCCACGTTCAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023942.2-1384s21c1
Sequence:CCGGGCACACTGGGCTATTGCTTTACTCGAGTAAAGCAATAGCCCAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-588s21c1
Sequence:CCGGGGAGTCCATCCTGCTACTGAACTCGAGTTCAGTAGCAGGATGGACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-734s21c1
Sequence:CCGGTGCTCAATGTCTCCAACAATCCTCGAGGATTGTTGGAGACATTGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-995s21c1
Sequence:CCGGTTGGGCGTGGTAGTGAGTTCTCTCGAGAGAACTCACTACCACGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023942
LRRC61 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 61
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023942.1-703s1c1
Sequence:CCGGGTAGTGAGTTCTACCAGCTGTCTCGAGACAGCTGGTAGAACTCACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-1270s21c1
Sequence:CCGGGTCTTCTGAACGTGGCCTATGCTCGAGCATAGGCCACGTTCAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023942.2-1384s21c1
Sequence:CCGGGCACACTGGGCTATTGCTTTACTCGAGTAAAGCAATAGCCCAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-588s21c1
Sequence:CCGGGGAGTCCATCCTGCTACTGAACTCGAGTTCAGTAGCAGGATGGACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-734s21c1
Sequence:CCGGTGCTCAATGTCTCCAACAATCCTCGAGGATTGTTGGAGACATTGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-995s21c1
Sequence:CCGGTTGGGCGTGGTAGTGAGTTCTCTCGAGAGAACTCACTACCACGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023942
LRRC61 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 61
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023942.1-703s1c1
Sequence:CCGGGTAGTGAGTTCTACCAGCTGTCTCGAGACAGCTGGTAGAACTCACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-1270s21c1
Sequence:CCGGGTCTTCTGAACGTGGCCTATGCTCGAGCATAGGCCACGTTCAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023942.2-1384s21c1
Sequence:CCGGGCACACTGGGCTATTGCTTTACTCGAGTAAAGCAATAGCCCAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-588s21c1
Sequence:CCGGGGAGTCCATCCTGCTACTGAACTCGAGTTCAGTAGCAGGATGGACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-734s21c1
Sequence:CCGGTGCTCAATGTCTCCAACAATCCTCGAGGATTGTTGGAGACATTGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023942.2-995s21c1
Sequence:CCGGTTGGGCGTGGTAGTGAGTTCTCTCGAGAGAACTCACTACCACGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)