EMAIL THIS PAGE TO A FRIEND

LRRC63

leucine rich repeat containing 63

108 Gene Product Result for
UniProtKB ID: Q05C16, Q5TBN0
Gene ID:
Mouse(70859) leucine rich repeat containing 63
Rat(364427) leucine rich repeat containing 63
sheep(101104324) leucine rich repeat containing 63
naked mole-rat(101700515) leucine rich repeat containing 63
chicken(100857395) leucine rich repeat containing 63
cow(100848618) leucine rich repeat containing 63
dog(476920) leucine rich repeat containing 63
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302084 ANTI-LRRC63 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_895010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_895010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_895010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001024609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024609 Rosetta Predictions human pricing
XM_001714777 Rosetta Predictions human pricing
XM_001716651 Rosetta Predictions human pricing
XM_001718341 Rosetta Predictions human pricing
NM_001024803 Rosetta Predictions rat pricing
XM_127820 Rosetta Predictions mouse pricing
XM_895010 Rosetta Predictions mouse pricing
XM_902368 Rosetta Predictions mouse pricing
XM_916478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208790 predicted 1310
2 SASI_Hs01_00208791 predicted 953
3 SASI_Hs01_00208792 predicted 1328
4 SASI_Hs01_00208793 predicted 1302
5 SASI_Hs01_00208794 predicted 1105
6 SASI_Hs01_00208795 predicted 1104
7 SASI_Hs01_00208796 predicted 1405
8 SASI_Hs01_00208797 predicted 541
9 SASI_Hs01_00208798 predicted 639
10 SASI_Hs01_00208799 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399395 predicted 1343
2 SASI_Hs02_00399396 predicted 1298
3 SASI_Hs02_00399397 predicted 671
4 SASI_Hs02_00399398 predicted 1413
5 SASI_Hs02_00399399 predicted 1101
6 SASI_Hs02_00399400 predicted 1092
7 SASI_Hs02_00399401 predicted 527
8 SASI_Hs02_00399402 predicted 631
9 SASI_Hs02_00399403 predicted 894
10 SASI_Hs02_00399404 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411957 predicted 1670
2 SASI_Hs02_00411958 predicted 1339
3 SASI_Hs02_00411959 predicted 1646
4 SASI_Hs02_00411960 predicted 950
5 SASI_Hs02_00411961 predicted 1295
6 SASI_Hs02_00411962 predicted 678
7 SASI_Hs02_00411963 predicted 1408
8 SASI_Hs02_00411964 predicted 1100
9 SASI_Hs02_00411965 predicted 528
10 SASI_Hs02_00411966 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423172 predicted 1339
2 SASI_Hs02_00423173 predicted 948
3 SASI_Hs02_00423174 predicted 1292
4 SASI_Hs02_00423175 predicted 672
5 SASI_Hs02_00423176 predicted 1416
6 SASI_Hs02_00423177 predicted 1099
7 SASI_Hs02_00423178 predicted 1303
8 SASI_Hs02_00423179 predicted 527
9 SASI_Hs02_00423180 predicted 635
10 SASI_Hs02_00423181 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061683 predicted 1389
2 SASI_Rn02_00202729 predicted 1201
3 SASI_Rn01_00061684 predicted 1160
4 SASI_Rn01_00061685 predicted 777
5 SASI_Rn01_00061687 predicted 1213
6 SASI_Rn01_00061688 predicted 1777
7 SASI_Rn01_00061689 predicted 396
8 SASI_Rn01_00061690 predicted 1273
9 SASI_Rn01_00061691 predicted 1397
10 SASI_Rn01_00061692 predicted 1635
11 SASI_Rn01_00061686 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207930 predicted 1351
2 SASI_Mm01_00207931 predicted 428
3 SASI_Mm01_00207932 predicted 1340
4 SASI_Mm01_00207933 predicted 1284
5 SASI_Mm01_00207934 predicted 748
6 SASI_Mm01_00207935 predicted 426
7 SASI_Mm01_00207936 predicted 393
8 SASI_Mm01_00207937 predicted 394
9 SASI_Mm01_00207938 predicted 266
10 SASI_Mm01_00207939 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250062 predicted 2034
2 SASI_Mm02_00429624 predicted 2036
3 SASI_Mm02_00429625 predicted 1578
4 SASI_Mm02_00429626 predicted 1655
5 SASI_Mm01_00250067 predicted 1889
6 SASI_Mm01_00250068 predicted 2036
7 SASI_Mm02_00429627 predicted 385
8 SASI_Mm02_00429628 predicted 371
9 SASI_Mm02_00429629 predicted 317
10 SASI_Mm01_00250069 predicted 1886
11 SASI_Mm01_00250063 predicted 2040
12 SASI_Mm01_00250064 predicted 2016
13 SASI_Mm01_00250065 predicted 1886
14 SASI_Mm01_00250066 predicted 1898
15 SASI_Mm01_00250070 predicted 1984
16 SASI_Mm01_00250071 predicted 1992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271401 predicted 315
2 SASI_Mm01_00271402 predicted 320
3 SASI_Mm01_00271403 predicted 375
4 SASI_Mm01_00271404 predicted 390
5 SASI_Mm01_00271405 predicted 392
6 SASI_Mm01_00271406 predicted 381
7 SASI_Mm01_00271407 predicted 334
8 SASI_Mm01_00271408 predicted 386
9 SASI_Mm01_00271409 predicted 360
10 SASI_Mm01_00271410 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440320 predicted 1446
2 SASI_Mm02_00440321 predicted 416
3 SASI_Mm02_00440322 predicted 1321
4 SASI_Mm02_00440323 predicted 1587
5 SASI_Mm02_00440324 predicted 730
6 SASI_Mm02_00440325 predicted 1659
7 SASI_Mm02_00440326 predicted 250
8 SASI_Mm02_00440327 predicted 1388
9 SASI_Mm02_00440328 predicted 318
10 SASI_Mm02_00440329 predicted 1886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_895010
LRRC63 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 63
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_895010.2-2261s21c1
Sequence:CCGGTTCCTGGAGAACACGTTTATACTCGAGTATAAACGTGTTCTCCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-690s21c1
Sequence:CCGGGATTCATCGCATCTAAGTTTACTCGAGTAAACTTAGATGCGATGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-1656s21c1
Sequence:CCGGTGAAGCTTAACTTGATCAAATCTCGAGATTTGATCAAGTTAAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-2043s21c1
Sequence:CCGGTCAGCAATGTCTCGTTCTATTCTCGAGAATAGAACGAGACATTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-1218s21c1
Sequence:CCGGTGACCACCCTGGCCATAATAACTCGAGTTATTATGGCCAGGGTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_895010
LRRC63 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 63
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_895010.2-2261s21c1
Sequence:CCGGTTCCTGGAGAACACGTTTATACTCGAGTATAAACGTGTTCTCCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-690s21c1
Sequence:CCGGGATTCATCGCATCTAAGTTTACTCGAGTAAACTTAGATGCGATGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-1656s21c1
Sequence:CCGGTGAAGCTTAACTTGATCAAATCTCGAGATTTGATCAAGTTAAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-2043s21c1
Sequence:CCGGTCAGCAATGTCTCGTTCTATTCTCGAGAATAGAACGAGACATTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-1218s21c1
Sequence:CCGGTGACCACCCTGGCCATAATAACTCGAGTTATTATGGCCAGGGTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_895010
LRRC63 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 63
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_895010.2-2261s21c1
Sequence:CCGGTTCCTGGAGAACACGTTTATACTCGAGTATAAACGTGTTCTCCAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-690s21c1
Sequence:CCGGGATTCATCGCATCTAAGTTTACTCGAGTAAACTTAGATGCGATGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-1656s21c1
Sequence:CCGGTGAAGCTTAACTTGATCAAATCTCGAGATTTGATCAAGTTAAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-2043s21c1
Sequence:CCGGTCAGCAATGTCTCGTTCTATTCTCGAGAATAGAACGAGACATTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_895010.2-1218s21c1
Sequence:CCGGTGACCACCCTGGCCATAATAACTCGAGTTATTATGGCCAGGGTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024609
LRRC63 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 63
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1090s1c1
Sequence:CCGGCACAGGCAGTCTGTGATAGAACTCGAGTTCTATCACAGACTGCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024609.1-1470s1c1
Sequence:CCGGCTTTGGCTTTCCAGTTGATATCTCGAGATATCAACTGGAAAGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-683s1c1
Sequence:CCGGGTAATTCAGCTTCTACTCGAACTCGAGTTCGAGTAGAAGCTGAATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024609.1-1362s1c1
Sequence:CCGGGCCCTCCTGTATTATCAATTACTCGAGTAATTGATAATACAGGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1247s1c1
Sequence:CCGGCAGCAACACGATATGAAACAACTCGAGTTGTTTCATATCGTGTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1201s1c1
Sequence:CCGGGAATCAGAGATACACGTTGTACTCGAGTACAACGTGTATCTCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1249s1c1
Sequence:CCGGGCAACACGATATGAAACAATACTCGAGTATTGTTTCATATCGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024609
LRRC63 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 63
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1090s1c1
Sequence:CCGGCACAGGCAGTCTGTGATAGAACTCGAGTTCTATCACAGACTGCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024609.1-1470s1c1
Sequence:CCGGCTTTGGCTTTCCAGTTGATATCTCGAGATATCAACTGGAAAGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-683s1c1
Sequence:CCGGGTAATTCAGCTTCTACTCGAACTCGAGTTCGAGTAGAAGCTGAATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024609.1-1362s1c1
Sequence:CCGGGCCCTCCTGTATTATCAATTACTCGAGTAATTGATAATACAGGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1247s1c1
Sequence:CCGGCAGCAACACGATATGAAACAACTCGAGTTGTTTCATATCGTGTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1201s1c1
Sequence:CCGGGAATCAGAGATACACGTTGTACTCGAGTACAACGTGTATCTCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1249s1c1
Sequence:CCGGGCAACACGATATGAAACAATACTCGAGTATTGTTTCATATCGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024609
LRRC63 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 63
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1090s1c1
Sequence:CCGGCACAGGCAGTCTGTGATAGAACTCGAGTTCTATCACAGACTGCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024609.1-1470s1c1
Sequence:CCGGCTTTGGCTTTCCAGTTGATATCTCGAGATATCAACTGGAAAGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-683s1c1
Sequence:CCGGGTAATTCAGCTTCTACTCGAACTCGAGTTCGAGTAGAAGCTGAATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024609.1-1362s1c1
Sequence:CCGGGCCCTCCTGTATTATCAATTACTCGAGTAATTGATAATACAGGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1247s1c1
Sequence:CCGGCAGCAACACGATATGAAACAACTCGAGTTGTTTCATATCGTGTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1201s1c1
Sequence:CCGGGAATCAGAGATACACGTTGTACTCGAGTACAACGTGTATCTCTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024609.1-1249s1c1
Sequence:CCGGGCAACACGATATGAAACAATACTCGAGTATTGTTTCATATCGTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)