EMAIL THIS PAGE TO A FRIEND

LRRC66

leucine rich repeat containing 66

64 Gene Product Result for
UniProtKB ID: Q68CR7
Gene ID:
Mouse(231296) leucine rich repeat containing 66
Rat(289587) leucine rich repeat containing 66
chicken(422761) leucine rich repeat containing 66
dog(482146) leucine rich repeat containing 66
domestic cat(101087575) leucine rich repeat containing 66
cow(516507) leucine rich repeat containing 66
Horse(100060601) leucine rich repeat containing 66
domestic guinea pig(100723097) leucine rich repeat containing 66
Domestic Rabbit(100357374) leucine rich repeat containing 66
sheep(101104319) leucine rich repeat containing 66
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001024611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024611 Rosetta Predictions human pricing
NM_001008763 Rosetta Predictions rat pricing
XM_579211 Rosetta Predictions rat pricing
NM_153568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181863 predicted 924
2 SASI_Hs02_00307186 predicted 1349
3 SASI_Hs01_00181864 predicted 535
4 SASI_Hs01_00181865 predicted 2594
5 SASI_Hs01_00181867 predicted 397
6 SASI_Hs01_00181868 predicted 2682
7 SASI_Hs01_00181869 predicted 227
8 SASI_Hs01_00181870 predicted 2365
9 SASI_Hs01_00181871 predicted 1537
10 SASI_Hs02_00307187 predicted 558
11 SASI_Hs01_00181862 predicted 1413
12 SASI_Hs01_00181866 predicted 2475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081580 predicted 1185
2 SASI_Rn01_00081581 predicted 288
3 SASI_Rn01_00081582 predicted 1913
4 SASI_Rn02_00199262 predicted 1216
5 SASI_Rn01_00081583 predicted 2137
6 SASI_Rn01_00081584 predicted 2221
7 SASI_Rn01_00081585 predicted 1895
8 SASI_Rn01_00081586 predicted 1296
9 SASI_Rn01_00081587 predicted 2333
10 SASI_Rn01_00081588 predicted 2286
11 SASI_Rn01_00081589 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171937 predicted 1184
2 SASI_Rn01_00171938 predicted 290
3 SASI_Rn01_00171939 predicted 1923
4 SASI_Rn01_00171940 predicted 2150
5 SASI_Rn01_00171941 predicted 2227
6 SASI_Rn01_00171942 predicted 1895
7 SASI_Rn01_00171943 predicted 1295
8 SASI_Rn01_00171944 predicted 2345
9 SASI_Rn01_00171945 predicted 2290
10 SASI_Rn01_00171946 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098441 predicted 722
2 SASI_Mm01_00098442 predicted 2343
3 SASI_Mm01_00098443 predicted 2456
4 SASI_Mm01_00098444 predicted 488
5 SASI_Mm01_00098445 predicted 1500
6 SASI_Mm01_00098446 predicted 542
7 SASI_Mm01_00098447 predicted 1217
8 SASI_Mm01_00098448 predicted 220
9 SASI_Mm02_00343371 predicted 1906
10 SASI_Mm02_00343372 predicted 2350
11 SASI_Mm01_00098440 predicted 2466
12 SASI_Mm01_00098449 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153568
LRRC66 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 66
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153568.1-2853s1c1
Sequence:CCGGCTGACAAATGTGGGCTCTATTCTCGAGAATAGAGCCCACATTTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-1263s1c1
Sequence:CCGGCTCAGATAATGCCTACTCAAACTCGAGTTTGAGTAGGCATTATCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-2630s1c1
Sequence:CCGGCCCGCAAGAGAAGTAAGCATTCTCGAGAATGCTTACTTCTCTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-2309s1c1
Sequence:CCGGCGCAAAGGATTCCAGAGAAATCTCGAGATTTCTCTGGAATCCTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-1262s1c1
Sequence:CCGGGCTCAGATAATGCCTACTCAACTCGAGTTGAGTAGGCATTATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153568
LRRC66 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 66
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153568.1-2853s1c1
Sequence:CCGGCTGACAAATGTGGGCTCTATTCTCGAGAATAGAGCCCACATTTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-1263s1c1
Sequence:CCGGCTCAGATAATGCCTACTCAAACTCGAGTTTGAGTAGGCATTATCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-2630s1c1
Sequence:CCGGCCCGCAAGAGAAGTAAGCATTCTCGAGAATGCTTACTTCTCTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-2309s1c1
Sequence:CCGGCGCAAAGGATTCCAGAGAAATCTCGAGATTTCTCTGGAATCCTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-1262s1c1
Sequence:CCGGGCTCAGATAATGCCTACTCAACTCGAGTTGAGTAGGCATTATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153568
LRRC66 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 66
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153568.1-2853s1c1
Sequence:CCGGCTGACAAATGTGGGCTCTATTCTCGAGAATAGAGCCCACATTTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-1263s1c1
Sequence:CCGGCTCAGATAATGCCTACTCAAACTCGAGTTTGAGTAGGCATTATCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-2630s1c1
Sequence:CCGGCCCGCAAGAGAAGTAAGCATTCTCGAGAATGCTTACTTCTCTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-2309s1c1
Sequence:CCGGCGCAAAGGATTCCAGAGAAATCTCGAGATTTCTCTGGAATCCTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153568.1-1262s1c1
Sequence:CCGGGCTCAGATAATGCCTACTCAACTCGAGTTGAGTAGGCATTATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024611
LRRC66 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 66
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-2157s1c1
Sequence:CCGGCCATAAGTTCAGAGAGTGCAACTCGAGTTGCACTCTCTGAACTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024611.1-2731s1c1
Sequence:CCGGCCTTCACAACAAGATCCTGAACTCGAGTTCAGGATCTTGTTGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024611.1-2926s1c1
Sequence:CCGGCCAAGAACCATGCACCATTATCTCGAGATAATGGTGCATGGTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-1591s1c1
Sequence:CCGGCCACATCCATAGGAATGATATCTCGAGATATCATTCCTATGGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-719s1c1
Sequence:CCGGCCAATGATGATCATAGCTCTACTCGAGTAGAGCTATGATCATCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-1258s1c1
Sequence:CCGGCCTGGACAACGCGTATTCAAACTCGAGTTTGAATACGCGTTGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024611
LRRC66 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 66
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-2157s1c1
Sequence:CCGGCCATAAGTTCAGAGAGTGCAACTCGAGTTGCACTCTCTGAACTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024611.1-2731s1c1
Sequence:CCGGCCTTCACAACAAGATCCTGAACTCGAGTTCAGGATCTTGTTGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024611.1-2926s1c1
Sequence:CCGGCCAAGAACCATGCACCATTATCTCGAGATAATGGTGCATGGTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-1591s1c1
Sequence:CCGGCCACATCCATAGGAATGATATCTCGAGATATCATTCCTATGGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-719s1c1
Sequence:CCGGCCAATGATGATCATAGCTCTACTCGAGTAGAGCTATGATCATCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-1258s1c1
Sequence:CCGGCCTGGACAACGCGTATTCAAACTCGAGTTTGAATACGCGTTGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024611
LRRC66 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 66
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-2157s1c1
Sequence:CCGGCCATAAGTTCAGAGAGTGCAACTCGAGTTGCACTCTCTGAACTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024611.1-2731s1c1
Sequence:CCGGCCTTCACAACAAGATCCTGAACTCGAGTTCAGGATCTTGTTGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024611.1-2926s1c1
Sequence:CCGGCCAAGAACCATGCACCATTATCTCGAGATAATGGTGCATGGTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-1591s1c1
Sequence:CCGGCCACATCCATAGGAATGATATCTCGAGATATCATTCCTATGGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-719s1c1
Sequence:CCGGCCAATGATGATCATAGCTCTACTCGAGTAGAGCTATGATCATCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024611.1-1258s1c1
Sequence:CCGGCCTGGACAACGCGTATTCAAACTCGAGTTTGAATACGCGTTGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)