EMAIL THIS PAGE TO A FRIEND

LRRC69

leucine rich repeat containing 69

70 Gene Product Result for
UniProtKB ID: Q6ZNQ3
Gene ID:
Mouse(73314) leucine rich repeat containing 69
Rat(500415) leucine rich repeat containing 69
sheep(101111296) leucine rich repeat containing 69
naked mole-rat(101717148) leucine rich repeat containing 69
domestic guinea pig(100729605) leucine rich repeat containing 69
cow(617064) leucine rich repeat containing 69
domestic cat(101080684) leucine rich repeat containing 69
dog(100683055) leucine rich repeat containing 69
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU226051 MISSION® esiRNA esiRNA targeting human LRRC69 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716998 Rosetta Predictions human pricing
XM_001717028 Rosetta Predictions human pricing
XM_001717145 Rosetta Predictions human pricing
NM_001134624 Rosetta Predictions rat pricing
NM_028499 Rosetta Predictions mouse pricing
XM_897771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414327 predicted 278
2 SASI_Hs02_00414328 predicted 357
3 SASI_Hs02_00414329 predicted 383
4 SASI_Hs02_00414330 predicted 520
5 SASI_Hs02_00414331 predicted 588
6 SASI_Hs02_00414332 predicted 203
7 SASI_Hs02_00414333 predicted 244
8 SASI_Hs02_00414334 predicted 677
9 SASI_Hs02_00414335 predicted 652
10 SASI_Hs02_00414336 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414573 predicted 224
2 SASI_Hs02_00414574 predicted 234
3 SASI_Hs02_00414575 predicted 212
4 SASI_Hs02_00414576 predicted 240
5 SASI_Hs02_00414577 predicted 212
6 SASI_Hs02_00414578 predicted 235
7 SASI_Hs02_00414579 predicted 252
8 SASI_Hs02_00414580 predicted 219
9 SASI_Hs02_00414581 predicted 208
10 SASI_Hs02_00414582 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415263 predicted 226
2 SASI_Hs02_00415264 predicted 240
3 SASI_Hs02_00415265 predicted 212
4 SASI_Hs02_00415266 predicted 240
5 SASI_Hs02_00415267 predicted 214
6 SASI_Hs02_00415268 predicted 229
7 SASI_Hs02_00415269 predicted 246
8 SASI_Hs02_00415270 predicted 217
9 SASI_Hs02_00415271 predicted 214
10 SASI_Hs02_00415272 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257719 predicted 809
2 SASI_Rn02_00257720 predicted 828
3 SASI_Rn02_00257721 predicted 468
4 SASI_Rn02_00257722 predicted 673
5 SASI_Rn02_00257723 predicted 523
6 SASI_Rn02_00257724 predicted 802
7 SASI_Rn02_00257725 predicted 410
8 SASI_Rn02_00257726 predicted 372
9 SASI_Rn02_00257727 predicted 383
10 SASI_Rn02_00257728 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333963 predicted 678
2 SASI_Mm02_00333964 predicted 819
3 SASI_Mm02_00333965 predicted 384
4 SASI_Mm02_00333966 predicted 976
5 SASI_Mm02_00333967 predicted 965
6 SASI_Mm02_00333968 predicted 767
7 SASI_Mm02_00333969 predicted 353
8 SASI_Mm02_00333970 predicted 418
9 SASI_Mm02_00333971 predicted 578
10 SASI_Mm02_00333972 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279746 predicted 820
2 SASI_Mm01_00279747 predicted 843
3 SASI_Mm01_00279748 predicted 772
4 SASI_Mm01_00279749 predicted 991
5 SASI_Mm01_00279750 predicted 978
6 SASI_Mm01_00279751 predicted 780
7 SASI_Mm01_00279752 predicted 892
8 SASI_Mm01_00279753 predicted 913
9 SASI_Mm01_00279754 predicted 961
10 SASI_Mm01_00279755 predicted 937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129890
LRRC69 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 69
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-544s21c1
Sequence:CCGGCATACCTGAAGAGATTAAATTCTCGAGAATTTAATCTCTTCAGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-506s21c1
Sequence:CCGGCTTGTTGAACTTCAACTTAACCTCGAGGTTAAGTTGAAGTTCAACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-266s21c1
Sequence:CCGGGTTCCGGAAGAGATGAAATATCTCGAGATATTTCATCTCTTCCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129890.1-1144s21c1
Sequence:CCGGCACAGATTATGCCCTACTTAACTCGAGTTAAGTAGGGCATAATCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-1005s21c1
Sequence:CCGGTGGTGCCTCTCCAAGTATTAACTCGAGTTAATACTTGGAGAGGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129890
LRRC69 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 69
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-544s21c1
Sequence:CCGGCATACCTGAAGAGATTAAATTCTCGAGAATTTAATCTCTTCAGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-506s21c1
Sequence:CCGGCTTGTTGAACTTCAACTTAACCTCGAGGTTAAGTTGAAGTTCAACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-266s21c1
Sequence:CCGGGTTCCGGAAGAGATGAAATATCTCGAGATATTTCATCTCTTCCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129890.1-1144s21c1
Sequence:CCGGCACAGATTATGCCCTACTTAACTCGAGTTAAGTAGGGCATAATCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-1005s21c1
Sequence:CCGGTGGTGCCTCTCCAAGTATTAACTCGAGTTAATACTTGGAGAGGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129890
LRRC69 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 69
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-544s21c1
Sequence:CCGGCATACCTGAAGAGATTAAATTCTCGAGAATTTAATCTCTTCAGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-506s21c1
Sequence:CCGGCTTGTTGAACTTCAACTTAACCTCGAGGTTAAGTTGAAGTTCAACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-266s21c1
Sequence:CCGGGTTCCGGAAGAGATGAAATATCTCGAGATATTTCATCTCTTCCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129890.1-1144s21c1
Sequence:CCGGCACAGATTATGCCCTACTTAACTCGAGTTAAGTAGGGCATAATCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129890.1-1005s21c1
Sequence:CCGGTGGTGCCTCTCCAAGTATTAACTCGAGTTAATACTTGGAGAGGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028499
LRRC69 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 69
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-746s21c1
Sequence:CCGGCTCTGGACTCTACGGGAAATACTCGAGTATTTCCCGTAGAGTCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-184s21c1
Sequence:CCGGGACCCAGTTGACGTTACTAAACTCGAGTTTAGTAACGTCAACTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-901s21c1
Sequence:CCGGTGAGTGGCTGGAGTGCGTTTACTCGAGTAAACGCACTCCAGCCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-393s21c1
Sequence:CCGGTAAGGAGTCTTACCTACTTAACTCGAGTTAAGTAGGTAAGACTCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-326s21c1
Sequence:CCGGCATCGCTTGATCATGCTTAATCTCGAGATTAAGCATGATCAAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028499
LRRC69 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 69
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-746s21c1
Sequence:CCGGCTCTGGACTCTACGGGAAATACTCGAGTATTTCCCGTAGAGTCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-184s21c1
Sequence:CCGGGACCCAGTTGACGTTACTAAACTCGAGTTTAGTAACGTCAACTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-901s21c1
Sequence:CCGGTGAGTGGCTGGAGTGCGTTTACTCGAGTAAACGCACTCCAGCCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-393s21c1
Sequence:CCGGTAAGGAGTCTTACCTACTTAACTCGAGTTAAGTAGGTAAGACTCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-326s21c1
Sequence:CCGGCATCGCTTGATCATGCTTAATCTCGAGATTAAGCATGATCAAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028499
LRRC69 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 69
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-746s21c1
Sequence:CCGGCTCTGGACTCTACGGGAAATACTCGAGTATTTCCCGTAGAGTCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-184s21c1
Sequence:CCGGGACCCAGTTGACGTTACTAAACTCGAGTTTAGTAACGTCAACTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-901s21c1
Sequence:CCGGTGAGTGGCTGGAGTGCGTTTACTCGAGTAAACGCACTCCAGCCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-393s21c1
Sequence:CCGGTAAGGAGTCTTACCTACTTAACTCGAGTTAAGTAGGTAAGACTCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028499.2-326s21c1
Sequence:CCGGCATCGCTTGATCATGCTTAATCTCGAGATTAAGCATGATCAAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)