EMAIL THIS PAGE TO A FRIEND

LRRC6

leucine rich repeat containing 6

63 Gene Product Result for
Synonyms: CILD19 LRTP TSLRP
UniProtKB ID: Q86X45, Q13648, Q4G183
Gene ID:
Human(23639) Summary: The protein encoded by this gene contains several leucine-rich repeat domains and appears to be involved in the motility of cilia. Defects in this gene are a cause of primary ciliary dyskinesia-19 (CILD19). Two transcript variants, one protein-coding and the other not, have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(54562) leucine rich repeat containing 6 (testis)
Rat(299920) leucine rich repeat containing 6
sheep(101102570) leucine rich repeat containing 6
naked mole-rat(101724715) leucine rich repeat containing 6
domestic guinea pig(100729342) leucine rich repeat containing 6
Zebrafish(432388) leucine rich repeat containing 6
chicken(420324) leucine rich repeat containing 6
cow(527979) leucine rich repeat containing 6
domestic cat(101088054) leucine rich repeat containing 6
dog(475104) leucine rich repeat containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012472 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120011 MISSION® esiRNA esiRNA human LRRC6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012472 Rosetta Predictions human pricing
NM_001025659 Rosetta Predictions rat pricing
NM_019457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114022 predicted 255
2 SASI_Hs01_00114023 predicted 560
3 SASI_Hs01_00114024 predicted 1146
4 SASI_Hs01_00114026 predicted 259
5 SASI_Hs01_00114027 predicted 593
6 SASI_Hs01_00114028 predicted 481
7 SASI_Hs01_00114029 predicted 549
8 SASI_Hs02_00344385 predicted 595
9 SASI_Hs01_00114030 predicted 1178
10 SASI_Hs01_00114031 predicted 329
11 SASI_Hs01_00114025 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091907 predicted 348
2 SASI_Rn01_00091909 predicted 413
3 SASI_Rn02_00203240 predicted 1073
4 SASI_Rn01_00091910 predicted 1225
5 SASI_Rn02_00203241 predicted 900
6 SASI_Rn02_00203242 predicted 1093
7 SASI_Rn01_00091911 predicted 463
8 SASI_Rn02_00203243 predicted 1058
9 SASI_Rn01_00091913 predicted 1348
10 SASI_Rn01_00091914 predicted 1407
11 SASI_Rn01_00091908 predicted 1325
12 SASI_Rn01_00091912 predicted 342
13 SASI_Rn01_00091915 predicted 257
14 SASI_Rn01_00091916 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053670 predicted 1153
2 SASI_Mm01_00053671 predicted 1581
3 SASI_Mm01_00053672 predicted 856
4 SASI_Mm02_00324449 predicted 1615
5 SASI_Mm02_00324450 predicted 1530
6 SASI_Mm01_00053674 predicted 870
7 SASI_Mm01_00053675 predicted 1336
8 SASI_Mm01_00053676 predicted 513
9 SASI_Mm02_00324451 predicted 213
10 SASI_Mm01_00053677 predicted 305
11 SASI_Mm01_00053673 predicted 1562
12 SASI_Mm01_00053678 predicted 330
13 SASI_Mm01_00053679 predicted 1533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012472
LRRC6 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1152s21c1
Sequence:CCGGCCCGATAGTAGTTCTGCTAAACTCGAGTTTAGCAGAACTACTATCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-178s21c1
Sequence:CCGGGACTAGAACACATTGATAAATCTCGAGATTTATCAATGTGTTCTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1085s21c1
Sequence:CCGGACCAACTTACGTGCGAGTAATCTCGAGATTACTCGCACGTAAGTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1034s21c1
Sequence:CCGGCCTTGCTGTCTATAGGTATATCTCGAGATATACCTATAGACAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-114s1c1
Sequence:CCGGGAACACAACGACTGTGTCATTCTCGAGAATGACACAGTCGTTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-832s1c1
Sequence:CCGGCCTGTTTGTTTACTCCTGAATCTCGAGATTCAGGAGTAAACAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-969s1c1
Sequence:CCGGCTAAATGTGAATGAGCCCAAACTCGAGTTTGGGCTCATTCACATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-354s1c1
Sequence:CCGGGACCTGACTGTGAATTTCATTCTCGAGAATGAAATTCACAGTCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-968s1c1
Sequence:CCGGCCTAAATGTGAATGAGCCCAACTCGAGTTGGGCTCATTCACATTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-1174s1c1
Sequence:CCGGGATCTCAGACAACGGGTCATTCTCGAGAATGACCCGTTGTCTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-539s1c1
Sequence:CCGGGATTAAGGCATTGCAGGACTACTCGAGTAGTCCTGCAATGCCTTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-1208s1c1
Sequence:CCGGGCCCAAGGTAGGAGAAGTAATCTCGAGATTACTTCTCCTACCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012472
LRRC6 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1152s21c1
Sequence:CCGGCCCGATAGTAGTTCTGCTAAACTCGAGTTTAGCAGAACTACTATCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-178s21c1
Sequence:CCGGGACTAGAACACATTGATAAATCTCGAGATTTATCAATGTGTTCTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1085s21c1
Sequence:CCGGACCAACTTACGTGCGAGTAATCTCGAGATTACTCGCACGTAAGTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1034s21c1
Sequence:CCGGCCTTGCTGTCTATAGGTATATCTCGAGATATACCTATAGACAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-114s1c1
Sequence:CCGGGAACACAACGACTGTGTCATTCTCGAGAATGACACAGTCGTTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-832s1c1
Sequence:CCGGCCTGTTTGTTTACTCCTGAATCTCGAGATTCAGGAGTAAACAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-969s1c1
Sequence:CCGGCTAAATGTGAATGAGCCCAAACTCGAGTTTGGGCTCATTCACATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-354s1c1
Sequence:CCGGGACCTGACTGTGAATTTCATTCTCGAGAATGAAATTCACAGTCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-968s1c1
Sequence:CCGGCCTAAATGTGAATGAGCCCAACTCGAGTTGGGCTCATTCACATTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-1174s1c1
Sequence:CCGGGATCTCAGACAACGGGTCATTCTCGAGAATGACCCGTTGTCTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-539s1c1
Sequence:CCGGGATTAAGGCATTGCAGGACTACTCGAGTAGTCCTGCAATGCCTTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-1208s1c1
Sequence:CCGGGCCCAAGGTAGGAGAAGTAATCTCGAGATTACTTCTCCTACCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012472
LRRC6 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1152s21c1
Sequence:CCGGCCCGATAGTAGTTCTGCTAAACTCGAGTTTAGCAGAACTACTATCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-178s21c1
Sequence:CCGGGACTAGAACACATTGATAAATCTCGAGATTTATCAATGTGTTCTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1085s21c1
Sequence:CCGGACCAACTTACGTGCGAGTAATCTCGAGATTACTCGCACGTAAGTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012472.3-1034s21c1
Sequence:CCGGCCTTGCTGTCTATAGGTATATCTCGAGATATACCTATAGACAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-114s1c1
Sequence:CCGGGAACACAACGACTGTGTCATTCTCGAGAATGACACAGTCGTTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-832s1c1
Sequence:CCGGCCTGTTTGTTTACTCCTGAATCTCGAGATTCAGGAGTAAACAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-969s1c1
Sequence:CCGGCTAAATGTGAATGAGCCCAAACTCGAGTTTGGGCTCATTCACATTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-354s1c1
Sequence:CCGGGACCTGACTGTGAATTTCATTCTCGAGAATGAAATTCACAGTCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-968s1c1
Sequence:CCGGCCTAAATGTGAATGAGCCCAACTCGAGTTGGGCTCATTCACATTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-1174s1c1
Sequence:CCGGGATCTCAGACAACGGGTCATTCTCGAGAATGACCCGTTGTCTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-539s1c1
Sequence:CCGGGATTAAGGCATTGCAGGACTACTCGAGTAGTCCTGCAATGCCTTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012472.3-1208s1c1
Sequence:CCGGGCCCAAGGTAGGAGAAGTAATCTCGAGATTACTTCTCCTACCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019457
LRRC6 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-489s1c1
Sequence:CCGGCAACAGTTAAAGTGGTTGGATCTCGAGATCCAACCACTTTAACTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1694s1c1
Sequence:CCGGCTATAATTGAACTTCGAGCTTCTCGAGAAGCTCGAAGTTCAATTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1818s1c1
Sequence:CCGGGCAAATTGTTCAAACTCAGAACTCGAGTTCTGAGTTTGAACAATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-903s1c1
Sequence:CCGGGCCCAAGATAAGTTAAGTGAACTCGAGTTCACTTAACTTATCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-284s1c1
Sequence:CCGGGAACTTAGCATTGAACAACATCTCGAGATGTTGTTCAATGCTAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1773s1c1
Sequence:CCGGGTCTTCACTTATGCAATAGATCTCGAGATCTATTGCATAAGTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1452s1c1
Sequence:CCGGCCAGACTTTGAGGATAACCCACTCGAGTGGGTTATCCTCAAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1100s1c1
Sequence:CCGGGCCAACTTACGTTCGAGTAATCTCGAGATTACTCGAACGTAAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1013s1c1
Sequence:CCGGGAAAGATGATGAGAAACACAACTCGAGTTGTGTTTCTCATCATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019457
LRRC6 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-489s1c1
Sequence:CCGGCAACAGTTAAAGTGGTTGGATCTCGAGATCCAACCACTTTAACTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1694s1c1
Sequence:CCGGCTATAATTGAACTTCGAGCTTCTCGAGAAGCTCGAAGTTCAATTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1818s1c1
Sequence:CCGGGCAAATTGTTCAAACTCAGAACTCGAGTTCTGAGTTTGAACAATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-903s1c1
Sequence:CCGGGCCCAAGATAAGTTAAGTGAACTCGAGTTCACTTAACTTATCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-284s1c1
Sequence:CCGGGAACTTAGCATTGAACAACATCTCGAGATGTTGTTCAATGCTAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1773s1c1
Sequence:CCGGGTCTTCACTTATGCAATAGATCTCGAGATCTATTGCATAAGTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1452s1c1
Sequence:CCGGCCAGACTTTGAGGATAACCCACTCGAGTGGGTTATCCTCAAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1100s1c1
Sequence:CCGGGCCAACTTACGTTCGAGTAATCTCGAGATTACTCGAACGTAAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1013s1c1
Sequence:CCGGGAAAGATGATGAGAAACACAACTCGAGTTGTGTTTCTCATCATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019457
LRRC6 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-489s1c1
Sequence:CCGGCAACAGTTAAAGTGGTTGGATCTCGAGATCCAACCACTTTAACTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1694s1c1
Sequence:CCGGCTATAATTGAACTTCGAGCTTCTCGAGAAGCTCGAAGTTCAATTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1818s1c1
Sequence:CCGGGCAAATTGTTCAAACTCAGAACTCGAGTTCTGAGTTTGAACAATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-903s1c1
Sequence:CCGGGCCCAAGATAAGTTAAGTGAACTCGAGTTCACTTAACTTATCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-284s1c1
Sequence:CCGGGAACTTAGCATTGAACAACATCTCGAGATGTTGTTCAATGCTAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019457.1-1773s1c1
Sequence:CCGGGTCTTCACTTATGCAATAGATCTCGAGATCTATTGCATAAGTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1452s1c1
Sequence:CCGGCCAGACTTTGAGGATAACCCACTCGAGTGGGTTATCCTCAAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1100s1c1
Sequence:CCGGGCCAACTTACGTTCGAGTAATCTCGAGATTACTCGAACGTAAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019457.1-1013s1c1
Sequence:CCGGGAAAGATGATGAGAAACACAACTCGAGTTGTGTTTCTCATCATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)