EMAIL THIS PAGE TO A FRIEND

LRRC71

leucine rich repeat containing 71

39 Gene Product Result for
Synonyms: C1orf92 RP11-356J7.1
UniProtKB ID: Q8N4P6, Q96M24
Gene ID:
Mouse(74485) leucine rich repeat containing 71
Rat(310689) leucine rich repeat containing 71
chicken(100857743) leucine rich repeat containing 71
domestic cat(101081113) leucine rich repeat containing 71
dog(612077) leucine rich repeat containing 71
cow(511219) leucine rich repeat containing 71
domestic guinea pig(100716845) leucine rich repeat containing 71
naked mole-rat(101726527) leucine rich repeat containing 71
sheep(101110294) leucine rich repeat containing 71
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144702 Rosetta Predictions human pricing
NM_001107701 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364630 predicted 662
2 SASI_Hs01_00024607 predicted 1232
3 SASI_Hs01_00024608 predicted 1413
4 SASI_Hs01_00024609 predicted 931
5 SASI_Hs01_00024610 predicted 1275
6 SASI_Hs01_00024611 predicted 1250
7 SASI_Hs01_00024615 predicted 1681
8 SASI_Hs01_00024616 predicted 1352
9 SASI_Hs02_00364631 predicted 950
10 SASI_Hs02_00364632 predicted 680
11 SASI_Hs01_00024612 predicted 1031
12 SASI_Hs01_00024613 predicted 1562
13 SASI_Hs01_00024614 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231425 predicted 834
2 SASI_Rn02_00231426 predicted 2178
3 SASI_Rn02_00231427 predicted 2005
4 SASI_Rn02_00231428 predicted 1727
5 SASI_Rn02_00231429 predicted 2136
6 SASI_Rn02_00231430 predicted 1213
7 SASI_Rn02_00231431 predicted 623
8 SASI_Rn02_00231432 predicted 750
9 SASI_Rn02_00231433 predicted 822
10 SASI_Rn02_00231434 predicted 1814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144702
LRRC71 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 71
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144702.2-1756s21c1
Sequence:CCGGATGTCCTGCGTACGCCATAATCTCGAGATTATGGCGTACGCAGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1039s1c1
Sequence:CCGGGAAGAGTCAGATGGTAGGGATCTCGAGATCCCTACCATCTGACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-683s1c1
Sequence:CCGGCGGAACAATAACATCGACGACCTCGAGGTCGTCGATGTTATTGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-682s1c1
Sequence:CCGGGCGGAACAATAACATCGACGACTCGAGTCGTCGATGTTATTGTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1084s1c1
Sequence:CCGGGACAGACAAGACGCAGACAATCTCGAGATTGTCTGCGTCTTGTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1034s1c1
Sequence:CCGGCGTGAGAAGAGTCAGATGGTACTCGAGTACCATCTGACTCTTCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144702.2-634s21c1
Sequence:CCGGTCTGGGTGTCTTCTCTAAATGCTCGAGCATTTAGAGAAGACACCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144702
LRRC71 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 71
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144702.2-1756s21c1
Sequence:CCGGATGTCCTGCGTACGCCATAATCTCGAGATTATGGCGTACGCAGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1039s1c1
Sequence:CCGGGAAGAGTCAGATGGTAGGGATCTCGAGATCCCTACCATCTGACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-683s1c1
Sequence:CCGGCGGAACAATAACATCGACGACCTCGAGGTCGTCGATGTTATTGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-682s1c1
Sequence:CCGGGCGGAACAATAACATCGACGACTCGAGTCGTCGATGTTATTGTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1084s1c1
Sequence:CCGGGACAGACAAGACGCAGACAATCTCGAGATTGTCTGCGTCTTGTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1034s1c1
Sequence:CCGGCGTGAGAAGAGTCAGATGGTACTCGAGTACCATCTGACTCTTCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144702.2-634s21c1
Sequence:CCGGTCTGGGTGTCTTCTCTAAATGCTCGAGCATTTAGAGAAGACACCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144702
LRRC71 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 71
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144702.2-1756s21c1
Sequence:CCGGATGTCCTGCGTACGCCATAATCTCGAGATTATGGCGTACGCAGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1039s1c1
Sequence:CCGGGAAGAGTCAGATGGTAGGGATCTCGAGATCCCTACCATCTGACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-683s1c1
Sequence:CCGGCGGAACAATAACATCGACGACCTCGAGGTCGTCGATGTTATTGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-682s1c1
Sequence:CCGGGCGGAACAATAACATCGACGACTCGAGTCGTCGATGTTATTGTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1084s1c1
Sequence:CCGGGACAGACAAGACGCAGACAATCTCGAGATTGTCTGCGTCTTGTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144702.1-1034s1c1
Sequence:CCGGCGTGAGAAGAGTCAGATGGTACTCGAGTACCATCTGACTCTTCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144702.2-634s21c1
Sequence:CCGGTCTGGGTGTCTTCTCTAAATGCTCGAGCATTTAGAGAAGACACCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)