EMAIL THIS PAGE TO A FRIEND

LRRC72

leucine rich repeat containing 72

35 Gene Product Result for
UniProtKB ID: A6NJI9
Gene ID:
Mouse(71156) leucine rich repeat containing 72
Rat(298963) leucine rich repeat containing 72
sheep(101104310) leucine rich repeat containing 72
naked mole-rat(101707288) leucine rich repeat containing 72
domestic guinea pig(100713649) leucine rich repeat containing 72
chicken(420592) leucine rich repeat containing 72
cow(783240) leucine rich repeat containing 72
domestic cat(101092507) leucine rich repeat containing 72
dog(100685168) leucine rich repeat containing 72
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001077099 Rosetta Predictions rat pricing
XM_216698 Rosetta Predictions rat pricing
NM_027699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355776 predicted 831
2 SASI_Rn02_00355777 predicted 333
3 SASI_Rn02_00355778 predicted 363
4 SASI_Rn02_00355779 predicted 663
5 SASI_Rn02_00355780 predicted 287
6 SASI_Rn02_00355781 predicted 592
7 SASI_Rn02_00355782 predicted 708
8 SASI_Rn02_00355783 predicted 665
9 SASI_Rn02_00355784 predicted 306
10 SASI_Rn02_00355785 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376730 predicted 1681
2 SASI_Rn02_00376731 predicted 308
3 SASI_Rn02_00376732 predicted 774
4 SASI_Rn02_00376733 predicted 1522
5 SASI_Rn02_00376734 predicted 519
6 SASI_Rn02_00376735 predicted 1454
7 SASI_Rn02_00376736 predicted 721
8 SASI_Rn02_00376737 predicted 1047
9 SASI_Rn02_00376738 predicted 1031
10 SASI_Rn02_00376739 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180668 predicted 301
2 SASI_Mm01_00180669 predicted 435
3 SASI_Mm01_00180670 predicted 338
4 SASI_Mm01_00180671 predicted 424
5 SASI_Mm01_00180672 predicted 427
6 SASI_Mm01_00180673 predicted 322
7 SASI_Mm01_00180674 predicted 424
8 SASI_Mm01_00180676 predicted 317
9 SASI_Mm01_00180677 predicted 328
10 SASI_Mm02_00332597 predicted 381
11 SASI_Mm01_00180675 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027699
LRRC72 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 72
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027699.2-379s21c1
Sequence:CCGGGAACTGGAACACCGTTCTAACCTCGAGGTTAGAACGGTGTTCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-232s1c1
Sequence:CCGGCCAAGTTACCAATAAAGCAAACTCGAGTTTGCTTTATTGGTAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027699.2-437s21c1
Sequence:CCGGGCCGCTGAGATGCTCATGATTCTCGAGAATCATGAGCATCTCAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027699.1-496s1c1
Sequence:CCGGCTGTTCGCTCACTCGTTAGAACTCGAGTTCTAACGAGTGAGCGAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-362s1c1
Sequence:CCGGGATGACGTTCACCAGCATGAACTCGAGTTCATGCTGGTGAACGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-183s1c1
Sequence:CCGGGTGATTCAATCAGTAGCATTTCTCGAGAAATGCTACTGATTGAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-297s1c1
Sequence:CCGGGTTGACAAGACACTGTTTGATCTCGAGATCAAACAGTGTCTTGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027699
LRRC72 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 72
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027699.2-379s21c1
Sequence:CCGGGAACTGGAACACCGTTCTAACCTCGAGGTTAGAACGGTGTTCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-232s1c1
Sequence:CCGGCCAAGTTACCAATAAAGCAAACTCGAGTTTGCTTTATTGGTAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027699.2-437s21c1
Sequence:CCGGGCCGCTGAGATGCTCATGATTCTCGAGAATCATGAGCATCTCAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027699.1-496s1c1
Sequence:CCGGCTGTTCGCTCACTCGTTAGAACTCGAGTTCTAACGAGTGAGCGAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-362s1c1
Sequence:CCGGGATGACGTTCACCAGCATGAACTCGAGTTCATGCTGGTGAACGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-183s1c1
Sequence:CCGGGTGATTCAATCAGTAGCATTTCTCGAGAAATGCTACTGATTGAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-297s1c1
Sequence:CCGGGTTGACAAGACACTGTTTGATCTCGAGATCAAACAGTGTCTTGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027699
LRRC72 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 72
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027699.2-379s21c1
Sequence:CCGGGAACTGGAACACCGTTCTAACCTCGAGGTTAGAACGGTGTTCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-232s1c1
Sequence:CCGGCCAAGTTACCAATAAAGCAAACTCGAGTTTGCTTTATTGGTAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027699.2-437s21c1
Sequence:CCGGGCCGCTGAGATGCTCATGATTCTCGAGAATCATGAGCATCTCAGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027699.1-496s1c1
Sequence:CCGGCTGTTCGCTCACTCGTTAGAACTCGAGTTCTAACGAGTGAGCGAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-362s1c1
Sequence:CCGGGATGACGTTCACCAGCATGAACTCGAGTTCATGCTGGTGAACGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-183s1c1
Sequence:CCGGGTGATTCAATCAGTAGCATTTCTCGAGAAATGCTACTGATTGAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027699.1-297s1c1
Sequence:CCGGGTTGACAAGACACTGTTTGATCTCGAGATCAAACAGTGTCTTGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)