EMAIL THIS PAGE TO A FRIEND

LRRC73

leucine rich repeat containing 73

93 Gene Product Result for
Synonyms: C6orf154
UniProtKB ID: Q5JTD7
Gene ID:
Mouse(224813) leucine rich repeat containing 73
Rat(501101) leucine rich repeat containing 73
dog(100684893) leucine rich repeat containing 73
domestic cat(101094347) leucine rich repeat containing 73
cow(615935) leucine rich repeat containing 73
domestic guinea pig(100733244) leucine rich repeat containing 73
naked mole-rat(101711287) leucine rich repeat containing 73
sheep(101113443) leucine rich repeat containing 73
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012974 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012974 Rosetta Predictions human pricing
NM_001024360 Rosetta Predictions rat pricing
NM_001111142 Rosetta Predictions mouse pricing
XM_001478757 Rosetta Predictions mouse pricing
XM_902425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112484 predicted 1868
2 SASI_Hs01_00112485 predicted 1787
3 SASI_Hs01_00112487 predicted 1864
4 SASI_Hs01_00112488 predicted 1486
5 SASI_Hs02_00306274 predicted 1424
6 SASI_Hs01_00112489 predicted 1318
7 SASI_Hs01_00112490 predicted 1333
8 SASI_Hs01_00112491 predicted 1500
9 SASI_Hs01_00112492 predicted 1510
10 SASI_Hs01_00112493 predicted 1334
11 SASI_Hs01_00112486 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073187 predicted 695
2 SASI_Rn01_00073188 predicted 1022
3 SASI_Rn01_00073189 predicted 1049
4 SASI_Rn01_00073191 predicted 974
5 SASI_Rn02_00202592 predicted 1043
6 SASI_Rn02_00202593 predicted 535
7 SASI_Rn01_00073192 predicted 684
8 SASI_Rn01_00073193 predicted 344
9 SASI_Rn01_00073194 predicted 708
10 SASI_Rn01_00073195 predicted 653
11 SASI_Rn01_00073186 predicted 439
12 SASI_Rn01_00073190 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306522 predicted 780
2 SASI_Mm02_00306523 predicted 1123
3 SASI_Mm02_00306524 predicted 700
4 SASI_Mm02_00306525 predicted 1065
5 SASI_Mm02_00306526 predicted 1149
6 SASI_Mm02_00306527 predicted 609
7 SASI_Mm02_00306528 predicted 1114
8 SASI_Mm02_00306529 predicted 1096
9 SASI_Mm02_00306530 predicted 657
10 SASI_Mm02_00306531 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00405160 predicted 781
2 SASI_Mm02_00405161 predicted 1120
3 SASI_Mm02_00405162 predicted 707
4 SASI_Mm02_00405163 predicted 1062
5 SASI_Mm02_00405164 predicted 1150
6 SASI_Mm02_00405165 predicted 611
7 SASI_Mm02_00405166 predicted 1105
8 SASI_Mm02_00405167 predicted 1099
9 SASI_Mm02_00405168 predicted 652
10 SASI_Mm02_00405169 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285577 predicted 1848
2 SASI_Mm01_00285578 predicted 2362
3 SASI_Mm01_00285579 predicted 2192
4 SASI_Mm01_00285580 predicted 2125
5 SASI_Mm01_00285581 predicted 2209
6 SASI_Mm01_00285582 predicted 2181
7 SASI_Mm01_00285583 predicted 2163
8 SASI_Mm01_00285584 predicted 2371
9 SASI_Mm01_00285585 predicted 2165
10 SASI_Mm01_00285586 predicted 2358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012974
LRRC73 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 73
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1871s1c1
Sequence:CCGGCACACCATTTCACTTATCTATCTCGAGATAGATAAGTGAAATGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1799s1c1
Sequence:CCGGGTGCTAATGACGTCAGGACTACTCGAGTAGTCCTGACGTCATTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1283s1c1
Sequence:CCGGGAAGCCATCAACCTCATCTGTCTCGAGACAGATGAGGTTGATGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1865s1c1
Sequence:CCGGCCTCTGCACACCATTTCACTTCTCGAGAAGTGAAATGGTGTGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1870s1c1
Sequence:CCGGGCACACCATTTCACTTATCTACTCGAGTAGATAAGTGAAATGGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1607s1c1
Sequence:CCGGGTGTTGGCTGAGAACAGCATTCTCGAGAATGCTGTTCTCAGCCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1788s1c1
Sequence:CCGGGCTCTCAGATGGTGCTAATGACTCGAGTCATTAGCACCATCTGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012974
LRRC73 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 73
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1871s1c1
Sequence:CCGGCACACCATTTCACTTATCTATCTCGAGATAGATAAGTGAAATGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1799s1c1
Sequence:CCGGGTGCTAATGACGTCAGGACTACTCGAGTAGTCCTGACGTCATTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1283s1c1
Sequence:CCGGGAAGCCATCAACCTCATCTGTCTCGAGACAGATGAGGTTGATGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1865s1c1
Sequence:CCGGCCTCTGCACACCATTTCACTTCTCGAGAAGTGAAATGGTGTGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1870s1c1
Sequence:CCGGGCACACCATTTCACTTATCTACTCGAGTAGATAAGTGAAATGGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1607s1c1
Sequence:CCGGGTGTTGGCTGAGAACAGCATTCTCGAGAATGCTGTTCTCAGCCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1788s1c1
Sequence:CCGGGCTCTCAGATGGTGCTAATGACTCGAGTCATTAGCACCATCTGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012974
LRRC73 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 73
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202804    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1871s1c1
Sequence:CCGGCACACCATTTCACTTATCTATCTCGAGATAGATAAGTGAAATGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1799s1c1
Sequence:CCGGGTGCTAATGACGTCAGGACTACTCGAGTAGTCCTGACGTCATTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1283s1c1
Sequence:CCGGGAAGCCATCAACCTCATCTGTCTCGAGACAGATGAGGTTGATGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1865s1c1
Sequence:CCGGCCTCTGCACACCATTTCACTTCTCGAGAAGTGAAATGGTGTGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012974.1-1870s1c1
Sequence:CCGGGCACACCATTTCACTTATCTACTCGAGTAGATAAGTGAAATGGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1607s1c1
Sequence:CCGGGTGTTGGCTGAGAACAGCATTCTCGAGAATGCTGTTCTCAGCCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012974.1-1788s1c1
Sequence:CCGGGCTCTCAGATGGTGCTAATGACTCGAGTCATTAGCACCATCTGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111142
LRRC73 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 73
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-368s21c1
Sequence:CCGGTTAACCTGGGCGTCGTGTCTACTCGAGTAGACACGACGCCCAGGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-888s21c1
Sequence:CCGGGTTGGCCGAGAACAGCATTAGCTCGAGCTAATGCTGTTCTCGGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-911s21c1
Sequence:CCGGCAGAGCTGCAACAACAGATTTCTCGAGAAATCTGTTGTTGCAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111142.1-1145s21c1
Sequence:CCGGCTTCTGCACAGCATTGCATTTCTCGAGAAATGCAATGCTGTGCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-780s21c1
Sequence:CCGGCCGTACCCTAGAAGTCCTAGACTCGAGTCTAGGACTTCTAGGGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111142
LRRC73 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 73
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-368s21c1
Sequence:CCGGTTAACCTGGGCGTCGTGTCTACTCGAGTAGACACGACGCCCAGGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-888s21c1
Sequence:CCGGGTTGGCCGAGAACAGCATTAGCTCGAGCTAATGCTGTTCTCGGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-911s21c1
Sequence:CCGGCAGAGCTGCAACAACAGATTTCTCGAGAAATCTGTTGTTGCAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111142.1-1145s21c1
Sequence:CCGGCTTCTGCACAGCATTGCATTTCTCGAGAAATGCAATGCTGTGCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-780s21c1
Sequence:CCGGCCGTACCCTAGAAGTCCTAGACTCGAGTCTAGGACTTCTAGGGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111142
LRRC73 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 73
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-368s21c1
Sequence:CCGGTTAACCTGGGCGTCGTGTCTACTCGAGTAGACACGACGCCCAGGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-888s21c1
Sequence:CCGGGTTGGCCGAGAACAGCATTAGCTCGAGCTAATGCTGTTCTCGGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-911s21c1
Sequence:CCGGCAGAGCTGCAACAACAGATTTCTCGAGAAATCTGTTGTTGCAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111142.1-1145s21c1
Sequence:CCGGCTTCTGCACAGCATTGCATTTCTCGAGAAATGCAATGCTGTGCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111142.1-780s21c1
Sequence:CCGGCCGTACCCTAGAAGTCCTAGACTCGAGTCTAGGACTTCTAGGGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)