EMAIL THIS PAGE TO A FRIEND

LRRC7

leucine rich repeat containing 7

168 Gene Product Result for
Synonyms: DENSIN
Gene ID:
Mouse(242274) leucine rich repeat containing 7
Rat(117284) leucine rich repeat containing 7
Zebrafish(566023) leucine rich repeat containing 7
cow(538844) leucine rich repeat containing 7
Horse(100068467) leucine rich repeat containing 7
domestic cat(101083021) leucine rich repeat containing 7
dog(490218) leucine rich repeat containing 7
chicken(424711) leucine rich repeat containing 7
domestic guinea pig(100720837) leucine rich repeat containing 7
naked mole-rat(101722028) leucine rich repeat containing 7
sheep(101117459) leucine rich repeat containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020794 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020794 Rosetta Predictions human pricing
NM_057142 Rosetta Predictions rat pricing
NM_001081358 Rosetta Predictions mouse pricing
XM_143575 Rosetta Predictions mouse pricing
XM_898867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125614 predicted 553
2 SASI_Hs01_00125615 predicted 4512
3 SASI_Hs02_00353953 predicted 1143
4 SASI_Hs01_00125616 predicted 971
5 SASI_Hs01_00125617 predicted 3727
6 SASI_Hs02_00353954 predicted 1815
7 SASI_Hs02_00353955 predicted 3541
8 SASI_Hs01_00125619 predicted 2986
9 SASI_Hs01_00125621 predicted 2870
10 SASI_Hs01_00125622 predicted 724
11 SASI_Hs01_00125618 predicted 667
12 SASI_Hs01_00125620 predicted 2714
13 SASI_Hs01_00125623 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094090 predicted 3065
2 SASI_Rn02_00267099 predicted 3264
3 SASI_Rn01_00094091 predicted 4579
4 SASI_Rn01_00094092 predicted 3914
5 SASI_Rn01_00094093 predicted 4241
6 SASI_Rn01_00094094 predicted 316
7 SASI_Rn01_00094095 predicted 892
8 SASI_Rn01_00094096 predicted 3898
9 SASI_Rn02_00267100 predicted 725
10 SASI_Rn01_00094097 predicted 1310
11 SASI_Rn01_00094089 predicted 2945
12 SASI_Rn01_00094098 predicted 2013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297631 predicted 3436
2 SASI_Mm02_00297632 predicted 4052
3 SASI_Mm02_00297633 predicted 2321
4 SASI_Mm02_00297634 predicted 4366
5 SASI_Mm02_00297635 predicted 4179
6 SASI_Mm02_00297636 predicted 5477
7 SASI_Mm02_00297637 predicted 1475
8 SASI_Mm02_00297638 predicted 4170
9 SASI_Mm02_00297639 predicted 4001
10 SASI_Mm02_00297640 predicted 1997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214716 predicted 3437
2 SASI_Mm01_00214717 predicted 4053
3 SASI_Mm01_00214718 predicted 2325
4 SASI_Mm01_00214719 predicted 4364
5 SASI_Mm01_00214720 predicted 4181
6 SASI_Mm01_00214721 predicted 5350
7 SASI_Mm01_00214722 predicted 1480
8 SASI_Mm01_00214723 predicted 4174
9 SASI_Mm01_00214724 predicted 4004
10 SASI_Mm01_00214725 predicted 3841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202535 predicted 3443
2 SASI_Mm01_00202536 predicted 4062
3 SASI_Mm01_00202537 predicted 2317
4 SASI_Mm01_00202538 predicted 4370
5 SASI_Mm01_00202539 predicted 4183
6 SASI_Mm01_00202540 predicted 5490
7 SASI_Mm01_00202541 predicted 1483
8 SASI_Mm01_00202542 predicted 4167
9 SASI_Mm01_00202543 predicted 4002
10 SASI_Mm01_00202544 predicted 3844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081358
LRRC7 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-1866s21c1
Sequence:CCGGAGACTTGACCTAGGCAATAATCTCGAGATTATTGCCTAGGTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-5397s21c1
Sequence:CCGGCCTCCGGACACCATTACTAAACTCGAGTTTAGTAATGGTGTCCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-2024s21c1
Sequence:CCGGCAGGATAGAAACGGTTGATATCTCGAGATATCAACCGTTTCTATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-3012s21c1
Sequence:CCGGACTCCTTACCCGGAGGATTTACTCGAGTAAATCCTCCGGGTAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081358
LRRC7 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 7
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-1866s21c1
Sequence:CCGGAGACTTGACCTAGGCAATAATCTCGAGATTATTGCCTAGGTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-5397s21c1
Sequence:CCGGCCTCCGGACACCATTACTAAACTCGAGTTTAGTAATGGTGTCCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-2024s21c1
Sequence:CCGGCAGGATAGAAACGGTTGATATCTCGAGATATCAACCGTTTCTATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-3012s21c1
Sequence:CCGGACTCCTTACCCGGAGGATTTACTCGAGTAAATCCTCCGGGTAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081358
LRRC7 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 7
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000252705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-1866s21c1
Sequence:CCGGAGACTTGACCTAGGCAATAATCTCGAGATTATTGCCTAGGTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-5397s21c1
Sequence:CCGGCCTCCGGACACCATTACTAAACTCGAGTTTAGTAATGGTGTCCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-2024s21c1
Sequence:CCGGCAGGATAGAAACGGTTGATATCTCGAGATATCAACCGTTTCTATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081358.1-3012s21c1
Sequence:CCGGACTCCTTACCCGGAGGATTTACTCGAGTAAATCCTCCGGGTAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020794
LRRC7 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-4245s1c1
Sequence:CCGGCCAGCAATTTCAGTCACCATTCTCGAGAATGGTGACTGAAATTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-283s1c1
Sequence:CCGGCCAACCACTATTGCTAGTTTACTCGAGTAAACTAGCAATAGTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-2777s1c1
Sequence:CCGGCGGAATCTTCTAAAGGTGTTACTCGAGTAACACCTTTAGAAGATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-628s1c1
Sequence:CCGGCCTGAAGTTCTGGATCAAATACTCGAGTATTTGATCCAGAACTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-2395s1c1
Sequence:CCGGGCCAACAGTAATCCTCTCTTACTCGAGTAAGAGAGGATTACTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020794
LRRC7 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-4245s1c1
Sequence:CCGGCCAGCAATTTCAGTCACCATTCTCGAGAATGGTGACTGAAATTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-283s1c1
Sequence:CCGGCCAACCACTATTGCTAGTTTACTCGAGTAAACTAGCAATAGTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-2777s1c1
Sequence:CCGGCGGAATCTTCTAAAGGTGTTACTCGAGTAACACCTTTAGAAGATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-628s1c1
Sequence:CCGGCCTGAAGTTCTGGATCAAATACTCGAGTATTTGATCCAGAACTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-2395s1c1
Sequence:CCGGGCCAACAGTAATCCTCTCTTACTCGAGTAAGAGAGGATTACTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020794
LRRC7 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-4245s1c1
Sequence:CCGGCCAGCAATTTCAGTCACCATTCTCGAGAATGGTGACTGAAATTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-283s1c1
Sequence:CCGGCCAACCACTATTGCTAGTTTACTCGAGTAAACTAGCAATAGTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-2777s1c1
Sequence:CCGGCGGAATCTTCTAAAGGTGTTACTCGAGTAACACCTTTAGAAGATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-628s1c1
Sequence:CCGGCCTGAAGTTCTGGATCAAATACTCGAGTATTTGATCCAGAACTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020794.1-2395s1c1
Sequence:CCGGGCCAACAGTAATCCTCTCTTACTCGAGTAAGAGAGGATTACTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)