EMAIL THIS PAGE TO A FRIEND

LRRC8B

leucine rich repeat containing 8 family, member B

47 Gene Product Result for
Synonyms: TA-LRRP TALRRP
UniProtKB ID: Q6P9F7, D3DT28, Q6UY21, Q8N106, Q92627
Gene ID:
Mouse(433926) leucine rich repeat containing 8 family, member B
Rat(305135) leucine rich repeat containing 8 family, member B
chicken(424516) leucine rich repeat containing 8 family, member B
domestic cat(101082930) leucine rich repeat containing 8 family, member B
cow(517584) leucine rich repeat containing 8 family, member B
Horse(100051898) leucine rich repeat containing 8 family, member B
dog(479958) leucine rich repeat containing 8 family, member B
domestic guinea pig(100715194) leucine rich repeat containing 8 family, member B
naked mole-rat(101696824) leucine rich repeat containing 8 family, member B
Domestic Rabbit(100358015) leucine rich repeat containing 8 family, member B
sheep(101121383) leucine rich repeat containing 8 family, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017950 Anti-LRRC8B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2101394 Anti-LRRC8B antibody produced in rabbit affinity isolated antibody canine, guinea pig, rat, bovine, human, mouse, horse, rabbit
immunohistochemistry, western blot pricing
SAB2103512 Anti-LRRC8B, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, bovine, human, rabbit, rat, horse, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015350 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015350 Rosetta Predictions human pricing
NM_001107204 Rosetta Predictions rat pricing
NM_001033550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054443 predicted 637
2 SASI_Hs01_00054444 predicted 1761
3 SASI_Hs01_00054445 predicted 2619
4 SASI_Hs01_00054446 predicted 1128
5 SASI_Hs01_00054448 predicted 1692
6 SASI_Hs01_00054449 predicted 2173
7 SASI_Hs01_00054450 predicted 1625
8 SASI_Hs01_00054451 predicted 1898
9 SASI_Hs02_00347666 predicted 1020
10 SASI_Hs02_00347667 predicted 2660
11 SASI_Hs01_00054442 predicted 610
12 SASI_Hs01_00054447 predicted 2490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226535 predicted 402
2 SASI_Rn02_00226536 predicted 2225
3 SASI_Rn02_00226537 predicted 924
4 SASI_Rn02_00226538 predicted 256
5 SASI_Rn02_00226539 predicted 1232
6 SASI_Rn02_00226540 predicted 1398
7 SASI_Rn02_00226541 predicted 714
8 SASI_Rn02_00226542 predicted 1463
9 SASI_Rn02_00226543 predicted 859
10 SASI_Rn02_00226544 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150200 predicted 1057
2 SASI_Mm01_00150201 predicted 2495
3 SASI_Mm01_00150202 predicted 2370
4 SASI_Mm01_00150203 predicted 1781
5 SASI_Mm01_00150204 predicted 1614
6 SASI_Mm01_00150205 predicted 2024
7 SASI_Mm01_00150206 predicted 2506
8 SASI_Mm01_00150207 predicted 2495
9 SASI_Mm01_00150208 predicted 2024
10 SASI_Mm01_00150209 predicted 2435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033550
LRRC8B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-1195s1c1
Sequence:CCGGGCAGGCATTTACAGGCTATAACTCGAGTTATAGCCTGTAAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-2239s1c1
Sequence:CCGGGCACAATAACATCGCTTACATCTCGAGATGTAAGCGATGTTATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-2438s1c1
Sequence:CCGGGCTGTGACCAACAATAACATTCTCGAGAATGTTATTGTTGGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-1763s1c1
Sequence:CCGGGCCTTTCTAGAGGAGAACTTACTCGAGTAAGTTCTCCTCTAGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-642s1c1
Sequence:CCGGGCTACGAGAAACAGCTCCATTCTCGAGAATGGAGCTGTTTCTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033550
LRRC8B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-1195s1c1
Sequence:CCGGGCAGGCATTTACAGGCTATAACTCGAGTTATAGCCTGTAAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-2239s1c1
Sequence:CCGGGCACAATAACATCGCTTACATCTCGAGATGTAAGCGATGTTATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-2438s1c1
Sequence:CCGGGCTGTGACCAACAATAACATTCTCGAGAATGTTATTGTTGGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-1763s1c1
Sequence:CCGGGCCTTTCTAGAGGAGAACTTACTCGAGTAAGTTCTCCTCTAGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-642s1c1
Sequence:CCGGGCTACGAGAAACAGCTCCATTCTCGAGAATGGAGCTGTTTCTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033550
LRRC8B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-1195s1c1
Sequence:CCGGGCAGGCATTTACAGGCTATAACTCGAGTTATAGCCTGTAAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-2239s1c1
Sequence:CCGGGCACAATAACATCGCTTACATCTCGAGATGTAAGCGATGTTATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-2438s1c1
Sequence:CCGGGCTGTGACCAACAATAACATTCTCGAGAATGTTATTGTTGGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-1763s1c1
Sequence:CCGGGCCTTTCTAGAGGAGAACTTACTCGAGTAAGTTCTCCTCTAGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033550.1-642s1c1
Sequence:CCGGGCTACGAGAAACAGCTCCATTCTCGAGAATGGAGCTGTTTCTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015350
VALIDATED
LRRC8B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015350.1-3384s1c1
Sequence:CCGGGTGACTATTATGATGAACCATCTCGAGATGGTTCATCATAATAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-603s1c1
Sequence:CCGGCCAGTCATCTTATCACATCTTCTCGAGAAGATGTGATAAGATGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-3372s1c1
Sequence:CCGGGATGAAGAATGGGTGACTATTCTCGAGAATAGTCACCCATTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015350.1-3425s1c1
Sequence:CCGGCAACTGAGTGTCTAGCCCTAACTCGAGTTAGGGCTAGACACTCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-2800s1c1
Sequence:CCGGGAGCTGTCAAACCTTACTCATCTCGAGATGAGTAAGGTTTGACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-881s21c1
Sequence:CCGGATGCCGTCTGTTACGAGAAACCTCGAGGTTTCTCGTAACAGACGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015350.2-3373s21c1
Sequence:CCGGGATGAAGAATGGGTGACTATTCTCGAGAATAGTCACCCATTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-858s21c1
Sequence:CCGGCCGACAGCAGTACTCCTATATCTCGAGATATAGGAGTACTGCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-634s21c1
Sequence:CCGGTGGGACGTCTTCTGGTATTACCTCGAGGTAATACCAGAAGACGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-2543s21c1
Sequence:CCGGAGCTCTCTTTGGACCATAATACTCGAGTATTATGGTCCAAAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015350
VALIDATED
LRRC8B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015350.1-3384s1c1
Sequence:CCGGGTGACTATTATGATGAACCATCTCGAGATGGTTCATCATAATAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-603s1c1
Sequence:CCGGCCAGTCATCTTATCACATCTTCTCGAGAAGATGTGATAAGATGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-3372s1c1
Sequence:CCGGGATGAAGAATGGGTGACTATTCTCGAGAATAGTCACCCATTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015350.1-3425s1c1
Sequence:CCGGCAACTGAGTGTCTAGCCCTAACTCGAGTTAGGGCTAGACACTCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-2800s1c1
Sequence:CCGGGAGCTGTCAAACCTTACTCATCTCGAGATGAGTAAGGTTTGACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-881s21c1
Sequence:CCGGATGCCGTCTGTTACGAGAAACCTCGAGGTTTCTCGTAACAGACGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015350.2-3373s21c1
Sequence:CCGGGATGAAGAATGGGTGACTATTCTCGAGAATAGTCACCCATTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-858s21c1
Sequence:CCGGCCGACAGCAGTACTCCTATATCTCGAGATATAGGAGTACTGCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-634s21c1
Sequence:CCGGTGGGACGTCTTCTGGTATTACCTCGAGGTAATACCAGAAGACGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-2543s21c1
Sequence:CCGGAGCTCTCTTTGGACCATAATACTCGAGTATTATGGTCCAAAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015350
VALIDATED
LRRC8B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015350.1-3384s1c1
Sequence:CCGGGTGACTATTATGATGAACCATCTCGAGATGGTTCATCATAATAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-603s1c1
Sequence:CCGGCCAGTCATCTTATCACATCTTCTCGAGAAGATGTGATAAGATGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-3372s1c1
Sequence:CCGGGATGAAGAATGGGTGACTATTCTCGAGAATAGTCACCCATTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015350.1-3425s1c1
Sequence:CCGGCAACTGAGTGTCTAGCCCTAACTCGAGTTAGGGCTAGACACTCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015350.1-2800s1c1
Sequence:CCGGGAGCTGTCAAACCTTACTCATCTCGAGATGAGTAAGGTTTGACAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-881s21c1
Sequence:CCGGATGCCGTCTGTTACGAGAAACCTCGAGGTTTCTCGTAACAGACGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015350.2-3373s21c1
Sequence:CCGGGATGAAGAATGGGTGACTATTCTCGAGAATAGTCACCCATTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-858s21c1
Sequence:CCGGCCGACAGCAGTACTCCTATATCTCGAGATATAGGAGTACTGCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-634s21c1
Sequence:CCGGTGGGACGTCTTCTGGTATTACCTCGAGGTAATACCAGAAGACGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015350.2-2543s21c1
Sequence:CCGGAGCTCTCTTTGGACCATAATACTCGAGTATTATGGTCCAAAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)