EMAIL THIS PAGE TO A FRIEND

LRRC8C

leucine rich repeat containing 8 family, member C

47 Gene Product Result for
Synonyms: AD158 FAD158
UniProtKB ID: Q8TDW0, B3KXS9, Q29RV6, Q9H075
Gene ID:
Mouse(100604) leucine rich repeat containing 8 family, member C
Rat(289443) leucine rich repeat containing 8 family, member C
sheep(101121640) leucine rich repeat containing 8 family, member C
Domestic Rabbit(100357755) leucine rich repeat containing 8 family, member C
naked mole-rat(101726711) leucine rich repeat containing 8 family, member C
domestic guinea pig(100715475) leucine rich repeat containing 8 family, member C
Zebrafish(571216) leucine rich repeat containing 8 family, member C
cow(527708) leucine rich repeat containing 8 family, member C
Horse(100061419) leucine rich repeat containing 8 family, member C
domestic cat(101083191) leucine rich repeat containing 8 family, member C
dog(490168) leucine rich repeat containing 8 family, member C
chicken(424515) leucine rich repeat containing 8 family, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029347 Anti-LRRC8C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032270 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008991 MISSION® esiRNA esiRNA targeting human LRRC8C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032270 Rosetta Predictions human pricing
NM_001037179 Rosetta Predictions rat pricing
NM_133897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064450 predicted 1163
2 SASI_Hs02_00359581 predicted 897
3 SASI_Hs02_00359582 predicted 1558
4 SASI_Hs01_00064451 predicted 555
5 SASI_Hs01_00064452 predicted 826
6 SASI_Hs01_00064453 predicted 772
7 SASI_Hs01_00064454 predicted 2122
8 SASI_Hs01_00064455 predicted 2079
9 SASI_Hs02_00359583 predicted 972
10 SASI_Hs01_00064456 predicted 1340
11 SASI_Hs01_00064457 predicted 1084
12 SASI_Hs01_00064458 predicted 1398
13 SASI_Hs01_00064459 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204246 predicted 991
2 SASI_Rn01_00037890 predicted 928
3 SASI_Rn01_00037891 predicted 1381
4 SASI_Rn01_00037892 predicted 2136
5 SASI_Rn01_00037893 predicted 1194
6 SASI_Rn01_00037894 predicted 1796
7 SASI_Rn01_00037895 predicted 2162
8 SASI_Rn01_00037896 predicted 2542
9 SASI_Rn01_00037897 predicted 1213
10 SASI_Rn01_00037898 predicted 2323
11 SASI_Rn01_00037899 predicted 1982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100668 predicted 379
2 SASI_Mm01_00100669 predicted 1271
3 SASI_Mm01_00100670 predicted 1930
4 SASI_Mm01_00100671 predicted 1958
5 SASI_Mm01_00100672 predicted 2095
6 SASI_Mm02_00338951 predicted 860
7 SASI_Mm01_00100674 predicted 2502
8 SASI_Mm01_00100675 predicted 1757
9 SASI_Mm01_00100676 predicted 1302
10 SASI_Mm01_00100677 predicted 2290
11 SASI_Mm01_00100673 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133897
LRRC8C MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-349s1c1
Sequence:CCGGCGGAGTGTTTGGATGTACTTTCTCGAGAAAGTACATCCAAACACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-1354s1c1
Sequence:CCGGGCTCCATATGATAGACCAGTACTCGAGTACTGGTCTATCATATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-1054s1c1
Sequence:CCGGCCTAATCATCATTGCCTACAACTCGAGTTGTAGGCAATGATGATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-2182s1c1
Sequence:CCGGCGCTTACATTCCAGAGCACATCTCGAGATGTGCTCTGGAATGTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-2334s1c1
Sequence:CCGGCCGAAATCGGAGTTCTGCAAACTCGAGTTTGCAGAACTCCGATTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-556s1c1
Sequence:CCGGGTACAGTTTCATCAACCAGATCTCGAGATCTGGTTGATGAAACTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133897.1-2672s1c1
Sequence:CCGGGAAACATGCTTCTACCAAATACTCGAGTATTTGGTAGAAGCATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.2-2632s1c1
Sequence:CCGGGATGAAAGCAGACTAACTTATCTCGAGATAAGTTAGTCTGCTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.2-1275s1c1
Sequence:CCGGGGGAATATTCCTTCGAGTATGCTCGAGCATACTCGAAGGAATATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133897
LRRC8C MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-349s1c1
Sequence:CCGGCGGAGTGTTTGGATGTACTTTCTCGAGAAAGTACATCCAAACACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-1354s1c1
Sequence:CCGGGCTCCATATGATAGACCAGTACTCGAGTACTGGTCTATCATATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-1054s1c1
Sequence:CCGGCCTAATCATCATTGCCTACAACTCGAGTTGTAGGCAATGATGATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-2182s1c1
Sequence:CCGGCGCTTACATTCCAGAGCACATCTCGAGATGTGCTCTGGAATGTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-2334s1c1
Sequence:CCGGCCGAAATCGGAGTTCTGCAAACTCGAGTTTGCAGAACTCCGATTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-556s1c1
Sequence:CCGGGTACAGTTTCATCAACCAGATCTCGAGATCTGGTTGATGAAACTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133897.1-2672s1c1
Sequence:CCGGGAAACATGCTTCTACCAAATACTCGAGTATTTGGTAGAAGCATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.2-2632s1c1
Sequence:CCGGGATGAAAGCAGACTAACTTATCTCGAGATAAGTTAGTCTGCTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.2-1275s1c1
Sequence:CCGGGGGAATATTCCTTCGAGTATGCTCGAGCATACTCGAAGGAATATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133897
LRRC8C MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-349s1c1
Sequence:CCGGCGGAGTGTTTGGATGTACTTTCTCGAGAAAGTACATCCAAACACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-1354s1c1
Sequence:CCGGGCTCCATATGATAGACCAGTACTCGAGTACTGGTCTATCATATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-1054s1c1
Sequence:CCGGCCTAATCATCATTGCCTACAACTCGAGTTGTAGGCAATGATGATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-2182s1c1
Sequence:CCGGCGCTTACATTCCAGAGCACATCTCGAGATGTGCTCTGGAATGTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-2334s1c1
Sequence:CCGGCCGAAATCGGAGTTCTGCAAACTCGAGTTTGCAGAACTCCGATTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.1-556s1c1
Sequence:CCGGGTACAGTTTCATCAACCAGATCTCGAGATCTGGTTGATGAAACTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133897.1-2672s1c1
Sequence:CCGGGAAACATGCTTCTACCAAATACTCGAGTATTTGGTAGAAGCATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.2-2632s1c1
Sequence:CCGGGATGAAAGCAGACTAACTTATCTCGAGATAAGTTAGTCTGCTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133897.2-1275s1c1
Sequence:CCGGGGGAATATTCCTTCGAGTATGCTCGAGCATACTCGAAGGAATATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032270
VALIDATED
LRRC8C MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032270.4-2770s21c1
Sequence:CCGGAGATCGCGTAAGGAGTATGTACTCGAGTACATACTCCTTACGCGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1374s1c1
Sequence:CCGGGCTACAGACAAATGCCCATAACTCGAGTTATGGGCATTTGTCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-207s1c1
Sequence:CCGGCGATTACCTCTCAGTAGCCATCTCGAGATGGCTACTGAGAGGTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032270.4-1270s21c1
Sequence:CCGGACCGTTCTCTACGGGAATATTCTCGAGAATATTCCCGTAGAGAACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032270.4-2191s21c1
Sequence:CCGGCCTACATCCCAGAGCATATAACTCGAGTTATATGCTCTGGGATGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-773s1c1
Sequence:CCGGCTGAGAAGTTTGTAGTTGATACTCGAGTATCAACTACAAACTTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1691s1c1
Sequence:CCGGGCTCTCTAAGTCATGATATTTCTCGAGAAATATCATGACTTAGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1266s1c1
Sequence:CCGGCCCTCTCTATTCCAAGAGATTCTCGAGAATCTCTTGGAATAGAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032270.2-2163s1c1
Sequence:CCGGCCTATGCAACAAGATCCGATACTCGAGTATCGGATCTTGTTGCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032270.2-2154s1c1
Sequence:CCGGCCACCTCTTCCTATGCAACAACTCGAGTTGTTGCATAGGAAGAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032270
VALIDATED
LRRC8C MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032270.4-2770s21c1
Sequence:CCGGAGATCGCGTAAGGAGTATGTACTCGAGTACATACTCCTTACGCGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1374s1c1
Sequence:CCGGGCTACAGACAAATGCCCATAACTCGAGTTATGGGCATTTGTCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-207s1c1
Sequence:CCGGCGATTACCTCTCAGTAGCCATCTCGAGATGGCTACTGAGAGGTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032270.4-1270s21c1
Sequence:CCGGACCGTTCTCTACGGGAATATTCTCGAGAATATTCCCGTAGAGAACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032270.4-2191s21c1
Sequence:CCGGCCTACATCCCAGAGCATATAACTCGAGTTATATGCTCTGGGATGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-773s1c1
Sequence:CCGGCTGAGAAGTTTGTAGTTGATACTCGAGTATCAACTACAAACTTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1691s1c1
Sequence:CCGGGCTCTCTAAGTCATGATATTTCTCGAGAAATATCATGACTTAGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1266s1c1
Sequence:CCGGCCCTCTCTATTCCAAGAGATTCTCGAGAATCTCTTGGAATAGAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032270.2-2163s1c1
Sequence:CCGGCCTATGCAACAAGATCCGATACTCGAGTATCGGATCTTGTTGCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032270.2-2154s1c1
Sequence:CCGGCCACCTCTTCCTATGCAACAACTCGAGTTGTTGCATAGGAAGAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032270
VALIDATED
LRRC8C MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032270.4-2770s21c1
Sequence:CCGGAGATCGCGTAAGGAGTATGTACTCGAGTACATACTCCTTACGCGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1374s1c1
Sequence:CCGGGCTACAGACAAATGCCCATAACTCGAGTTATGGGCATTTGTCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-207s1c1
Sequence:CCGGCGATTACCTCTCAGTAGCCATCTCGAGATGGCTACTGAGAGGTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032270.4-1270s21c1
Sequence:CCGGACCGTTCTCTACGGGAATATTCTCGAGAATATTCCCGTAGAGAACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032270.4-2191s21c1
Sequence:CCGGCCTACATCCCAGAGCATATAACTCGAGTTATATGCTCTGGGATGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-773s1c1
Sequence:CCGGCTGAGAAGTTTGTAGTTGATACTCGAGTATCAACTACAAACTTCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1691s1c1
Sequence:CCGGGCTCTCTAAGTCATGATATTTCTCGAGAAATATCATGACTTAGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032270.2-1266s1c1
Sequence:CCGGCCCTCTCTATTCCAAGAGATTCTCGAGAATCTCTTGGAATAGAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032270.2-2163s1c1
Sequence:CCGGCCTATGCAACAAGATCCGATACTCGAGTATCGGATCTTGTTGCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032270.2-2154s1c1
Sequence:CCGGCCACCTCTTCCTATGCAACAACTCGAGTTGTTGCATAGGAAGAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)