EMAIL THIS PAGE TO A FRIEND

LRRC8D

leucine rich repeat containing 8 family, member D

96 Gene Product Result for
Synonyms: LRRC5
UniProtKB ID: Q7L1W4, D3DT29, Q6UWB2, Q9NVW3
Gene ID:
Mouse(231549) leucine rich repeat containing 8D
Rat(305131) leucine rich repeat containing 8 family, member D
chicken(424513) leucine rich repeat containing 8 family, member D
domestic cat(101083608) leucine rich repeat containing 8 family, member D
cow(539204) leucine rich repeat containing 8 family, member D
Horse(100061270) leucine rich repeat containing 8 family, member D
dog(490167) leucine rich repeat containing 8 family, member D
domestic guinea pig(100715756) leucine rich repeat containing 8 family, member D
naked mole-rat(101725484) leucine rich repeat containing 8 family, member D
Domestic Rabbit(100345432) leucine rich repeat containing 8 family, member D
sheep(101121894) leucine rich repeat containing 8 family, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018103 Rosetta Predictions human pricing
NM_001008338 Rosetta Predictions rat pricing
NM_001122768 Rosetta Predictions mouse pricing
NM_178701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351290 predicted 2471
2 SASI_Hs01_00087410 predicted 1358
3 SASI_Hs01_00087411 predicted 2173
4 SASI_Hs01_00087412 predicted 455
5 SASI_Hs01_00087413 predicted 1414
6 SASI_Hs01_00087415 predicted 1528
7 SASI_Hs01_00087417 predicted 1121
8 SASI_Hs01_00087418 predicted 1643
9 SASI_Hs01_00087419 predicted 715
10 SASI_Hs02_00351291 predicted 768
11 SASI_Hs01_00087414 predicted 884
12 SASI_Hs01_00087416 predicted 2107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056583 predicted 213
2 SASI_Rn01_00056584 predicted 1516
3 SASI_Rn01_00056586 predicted 1764
4 SASI_Rn01_00056587 predicted 2701
5 SASI_Rn02_00199086 predicted 2305
6 SASI_Rn02_00199087 predicted 2362
7 SASI_Rn01_00056588 predicted 851
8 SASI_Rn01_00056589 predicted 1658
9 SASI_Rn01_00056590 predicted 458
10 SASI_Rn01_00056591 predicted 255
11 SASI_Rn01_00056585 predicted 1480
12 SASI_Rn01_00056592 predicted 1948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309409 predicted 2024
2 SASI_Mm02_00309410 predicted 1767
3 SASI_Mm02_00309411 predicted 1045
4 SASI_Mm02_00309412 predicted 1061
5 SASI_Mm02_00309413 predicted 2486
6 SASI_Mm02_00309414 predicted 508
7 SASI_Mm02_00309415 predicted 1113
8 SASI_Mm02_00309416 predicted 2931
9 SASI_Mm02_00309417 predicted 2996
10 SASI_Mm02_00309418 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349200 predicted 1207
2 SASI_Mm01_00163395 predicted 2008
3 SASI_Mm01_00163397 predicted 1760
4 SASI_Mm01_00163398 predicted 1031
5 SASI_Mm01_00163399 predicted 1048
6 SASI_Mm01_00163400 predicted 2484
7 SASI_Mm01_00163402 predicted 503
8 SASI_Mm01_00163403 predicted 1096
9 SASI_Mm02_00349201 predicted 2923
10 SASI_Mm02_00349202 predicted 1277
11 SASI_Mm01_00163396 predicted 2597
12 SASI_Mm01_00163401 predicted 1390
13 SASI_Mm01_00163404 predicted 1574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178701
VALIDATED
LRRC8D MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member D
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178701.2-2099s1c1
Sequence:CCGGGCTGTACTTGATCGGCAATTTCTCGAGAAATTGCCGATCAAGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178701.2-3531s1c1
Sequence:CCGGGCCAAACTCATAATCTTAGATCTCGAGATCTAAGATTATGAGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178701.2-925s1c1
Sequence:CCGGCCATCATCCTTATGGTCAGTACTCGAGTACTGACCATAAGGATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178701.2-2940s1c1
Sequence:CCGGGCATTGAATCAAGATGTCAATCTCGAGATTGACATCTTGATTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178701.2-1302s1c1
Sequence:CCGGGAAGACAGTGACTTGATCTATCTCGAGATAGATCAAGTCACTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178701.3-2205s1c1
Sequence:CCGGCCACGTGAAGAGTAATCTAACCTCGAGGTTAGATTACTCTTCACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178701.3-3058s1c1
Sequence:CCGGGATGCTCACTTGCAAGTTATTCTCGAGAATAACTTGCAAGTGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178701
VALIDATED
LRRC8D MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member D
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178701.2-2099s1c1
Sequence:CCGGGCTGTACTTGATCGGCAATTTCTCGAGAAATTGCCGATCAAGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178701.2-3531s1c1
Sequence:CCGGGCCAAACTCATAATCTTAGATCTCGAGATCTAAGATTATGAGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178701.2-925s1c1
Sequence:CCGGCCATCATCCTTATGGTCAGTACTCGAGTACTGACCATAAGGATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178701.2-2940s1c1
Sequence:CCGGGCATTGAATCAAGATGTCAATCTCGAGATTGACATCTTGATTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178701.2-1302s1c1
Sequence:CCGGGAAGACAGTGACTTGATCTATCTCGAGATAGATCAAGTCACTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178701.3-2205s1c1
Sequence:CCGGCCACGTGAAGAGTAATCTAACCTCGAGGTTAGATTACTCTTCACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178701.3-3058s1c1
Sequence:CCGGGATGCTCACTTGCAAGTTATTCTCGAGAATAACTTGCAAGTGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178701
VALIDATED
LRRC8D MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member D
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178701.2-2099s1c1
Sequence:CCGGGCTGTACTTGATCGGCAATTTCTCGAGAAATTGCCGATCAAGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178701.2-3531s1c1
Sequence:CCGGGCCAAACTCATAATCTTAGATCTCGAGATCTAAGATTATGAGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178701.2-925s1c1
Sequence:CCGGCCATCATCCTTATGGTCAGTACTCGAGTACTGACCATAAGGATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178701.2-2940s1c1
Sequence:CCGGGCATTGAATCAAGATGTCAATCTCGAGATTGACATCTTGATTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178701.2-1302s1c1
Sequence:CCGGGAAGACAGTGACTTGATCTATCTCGAGATAGATCAAGTCACTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178701.3-2205s1c1
Sequence:CCGGCCACGTGAAGAGTAATCTAACCTCGAGGTTAGATTACTCTTCACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217373    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178701.3-3058s1c1
Sequence:CCGGGATGCTCACTTGCAAGTTATTCTCGAGAATAACTTGCAAGTGAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018103
VALIDATED
LRRC8D MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2984s1c1
Sequence:CCGGGCAGGAACAACTTCCTAGATTCTCGAGAATCTAGGAAGTTGTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-3089s1c1
Sequence:CCGGGAAGGCTGATAGAAGACATAACTCGAGTTATGTCTTCTATCAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2900s1c1
Sequence:CCGGGAAGTCAAAGAGGCATTGAATCTCGAGATTCAATGCCTCTTTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2899s1c1
Sequence:CCGGCGAAGTCAAAGAGGCATTGAACTCGAGTTCAATGCCTCTTTGACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-1660s1c1
Sequence:CCGGCCAGCTATATTCCAAGCGTTTCTCGAGAAACGCTTGGAATATAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018103.4-687s21c1
Sequence:CCGGGGCGGACAACAAACGACATTTCTCGAGAAATGTCGTTTGTTGTCCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-1309s21c1
Sequence:CCGGAGATAGTGACTTGATCTATAACTCGAGTTATAGATCAAGTCACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-1693s21c1
Sequence:CCGGCCAGCTATATTCCAAGCGTTTCTCGAGAAACGCTTGGAATATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018103.4-3396s21c1
Sequence:CCGGGCTTTAACTCCGTTCACTAAACTCGAGTTTAGTGAACGGAGTTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-2933s21c1
Sequence:CCGGGAAGTCAAAGAGGCATTGAATCTCGAGATTCAATGCCTCTTTGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018103
VALIDATED
LRRC8D MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2984s1c1
Sequence:CCGGGCAGGAACAACTTCCTAGATTCTCGAGAATCTAGGAAGTTGTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-3089s1c1
Sequence:CCGGGAAGGCTGATAGAAGACATAACTCGAGTTATGTCTTCTATCAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2900s1c1
Sequence:CCGGGAAGTCAAAGAGGCATTGAATCTCGAGATTCAATGCCTCTTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2899s1c1
Sequence:CCGGCGAAGTCAAAGAGGCATTGAACTCGAGTTCAATGCCTCTTTGACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-1660s1c1
Sequence:CCGGCCAGCTATATTCCAAGCGTTTCTCGAGAAACGCTTGGAATATAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018103.4-687s21c1
Sequence:CCGGGGCGGACAACAAACGACATTTCTCGAGAAATGTCGTTTGTTGTCCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-1309s21c1
Sequence:CCGGAGATAGTGACTTGATCTATAACTCGAGTTATAGATCAAGTCACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-1693s21c1
Sequence:CCGGCCAGCTATATTCCAAGCGTTTCTCGAGAAACGCTTGGAATATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018103.4-3396s21c1
Sequence:CCGGGCTTTAACTCCGTTCACTAAACTCGAGTTTAGTGAACGGAGTTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-2933s21c1
Sequence:CCGGGAAGTCAAAGAGGCATTGAATCTCGAGATTCAATGCCTCTTTGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018103
VALIDATED
LRRC8D MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2984s1c1
Sequence:CCGGGCAGGAACAACTTCCTAGATTCTCGAGAATCTAGGAAGTTGTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-3089s1c1
Sequence:CCGGGAAGGCTGATAGAAGACATAACTCGAGTTATGTCTTCTATCAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2900s1c1
Sequence:CCGGGAAGTCAAAGAGGCATTGAATCTCGAGATTCAATGCCTCTTTGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-2899s1c1
Sequence:CCGGCGAAGTCAAAGAGGCATTGAACTCGAGTTCAATGCCTCTTTGACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018103.3-1660s1c1
Sequence:CCGGCCAGCTATATTCCAAGCGTTTCTCGAGAAACGCTTGGAATATAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018103.4-687s21c1
Sequence:CCGGGGCGGACAACAAACGACATTTCTCGAGAAATGTCGTTTGTTGTCCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-1309s21c1
Sequence:CCGGAGATAGTGACTTGATCTATAACTCGAGTTATAGATCAAGTCACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-1693s21c1
Sequence:CCGGCCAGCTATATTCCAAGCGTTTCTCGAGAAACGCTTGGAATATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018103.4-3396s21c1
Sequence:CCGGGCTTTAACTCCGTTCACTAAACTCGAGTTTAGTGAACGGAGTTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018103.4-2933s21c1
Sequence:CCGGGAAGTCAAAGAGGCATTGAATCTCGAGATTCAATGCCTCTTTGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)