EMAIL THIS PAGE TO A FRIEND

LRRC8E

leucine rich repeat containing 8 family, member E

51 Gene Product Result for
UniProtKB ID: Q6NSJ5, B3KR78, Q2YDY3, Q7L236, Q8N3B0, Q9H5H8
Gene ID:
Human(80131) Summary: This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Mouse(72267) leucine rich repeat containing 8 family, member E
Rat(304203) leucine rich repeat containing 8 family, member E
domestic cat(101095552) leucine rich repeat containing 8 family, member E
dog(485003) leucine rich repeat containing 8 family, member E
cow(507824) leucine rich repeat containing 8 family, member E
Horse(100060781) leucine rich repeat containing 8 family, member E
sheep(101102306) leucine rich repeat containing 8 family, member E
naked mole-rat(101709943) leucine rich repeat containing 8 family, member E
domestic guinea pig(100735411) leucine rich repeat containing 8 family, member E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV49916 Anti-LRRC8E antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse, rabbit, human, bovine, rat, dog
western blot pricing
HPA020466 Anti-LRRC8E antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025061 Rosetta Predictions human pricing
NM_001034139 Rosetta Predictions rat pricing
NM_028175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204888 predicted 1310
2 SASI_Hs01_00204889 predicted 1065
3 SASI_Hs01_00204891 predicted 1020
4 SASI_Hs01_00204893 predicted 448
5 SASI_Hs01_00204894 predicted 2009
6 SASI_Hs01_00204895 predicted 781
7 SASI_Hs02_00357724 predicted 956
8 SASI_Hs01_00204896 predicted 2285
9 SASI_Hs01_00204897 predicted 349
10 SASI_Hs02_00357725 predicted 1274
11 SASI_Hs01_00204890 predicted 1320
12 SASI_Hs01_00204892 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096286 predicted 941
2 SASI_Rn01_00096287 predicted 2236
3 SASI_Rn01_00096288 predicted 735
4 SASI_Rn01_00096289 predicted 1238
5 SASI_Rn01_00096290 predicted 1177
6 SASI_Rn01_00096291 predicted 2216
7 SASI_Rn02_00203992 predicted 887
8 SASI_Rn01_00096292 predicted 1724
9 SASI_Rn01_00096293 predicted 433
10 SASI_Rn01_00096294 predicted 1785
11 SASI_Rn01_00096295 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036627 predicted 1881
2 SASI_Mm01_00036628 predicted 958
3 SASI_Mm01_00036629 predicted 531
4 SASI_Mm01_00036630 predicted 988
5 SASI_Mm01_00036631 predicted 2623
6 SASI_Mm01_00036632 predicted 871
7 SASI_Mm01_00036633 predicted 1236
8 SASI_Mm01_00036634 predicted 542
9 SASI_Mm02_00333440 predicted 1678
10 SASI_Mm01_00036635 predicted 1773
11 SASI_Mm01_00036636 predicted 1918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025061
LRRC8E MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-1274s1c1
Sequence:CCGGCCGTCTAAAGCAGCTCAATCTCTCGAGAGATTGAGCTGCTTTAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025061.3-1558s21c1
Sequence:CCGGTGAAGGTGATGCGCGTCAAATCTCGAGATTTGACGCGCATCACCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-1038s1c1
Sequence:CCGGGCCTTCTGTTACATCTCCTTTCTCGAGAAAGGAGATGTAACAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025061.3-2807s1c1
Sequence:CCGGCCTGGATATTCCAGCTCAATTCTCGAGAATTGAGCTGGAATATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-2072s1c1
Sequence:CCGGGCTCTACCTCAGCTACAACAACTCGAGTTGTTGTAGCTGAGGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-562s1c1
Sequence:CCGGGCAAGTGTTTCGACTCTCCATCTCGAGATGGAGAGTCGAAACACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025061.3-274s21c1
Sequence:CCGGATGAGCTCCAGGAGAACTTATCTCGAGATAAGTTCTCCTGGAGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025061.3-2968s21c1
Sequence:CCGGTCCGAACAATGGTTCTCATTTCTCGAGAAATGAGAACCATTGTTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-246s1c1
Sequence:CCGGCAGGACAAGATCATCTGTCTACTCGAGTAGACAGATGATCTTGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025061
LRRC8E MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-1274s1c1
Sequence:CCGGCCGTCTAAAGCAGCTCAATCTCTCGAGAGATTGAGCTGCTTTAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025061.3-1558s21c1
Sequence:CCGGTGAAGGTGATGCGCGTCAAATCTCGAGATTTGACGCGCATCACCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-1038s1c1
Sequence:CCGGGCCTTCTGTTACATCTCCTTTCTCGAGAAAGGAGATGTAACAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025061.3-2807s1c1
Sequence:CCGGCCTGGATATTCCAGCTCAATTCTCGAGAATTGAGCTGGAATATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-2072s1c1
Sequence:CCGGGCTCTACCTCAGCTACAACAACTCGAGTTGTTGTAGCTGAGGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-562s1c1
Sequence:CCGGGCAAGTGTTTCGACTCTCCATCTCGAGATGGAGAGTCGAAACACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025061.3-274s21c1
Sequence:CCGGATGAGCTCCAGGAGAACTTATCTCGAGATAAGTTCTCCTGGAGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025061.3-2968s21c1
Sequence:CCGGTCCGAACAATGGTTCTCATTTCTCGAGAAATGAGAACCATTGTTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-246s1c1
Sequence:CCGGCAGGACAAGATCATCTGTCTACTCGAGTAGACAGATGATCTTGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025061
LRRC8E MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-1274s1c1
Sequence:CCGGCCGTCTAAAGCAGCTCAATCTCTCGAGAGATTGAGCTGCTTTAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025061.3-1558s21c1
Sequence:CCGGTGAAGGTGATGCGCGTCAAATCTCGAGATTTGACGCGCATCACCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-1038s1c1
Sequence:CCGGGCCTTCTGTTACATCTCCTTTCTCGAGAAAGGAGATGTAACAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025061.3-2807s1c1
Sequence:CCGGCCTGGATATTCCAGCTCAATTCTCGAGAATTGAGCTGGAATATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-2072s1c1
Sequence:CCGGGCTCTACCTCAGCTACAACAACTCGAGTTGTTGTAGCTGAGGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-562s1c1
Sequence:CCGGGCAAGTGTTTCGACTCTCCATCTCGAGATGGAGAGTCGAAACACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025061.3-274s21c1
Sequence:CCGGATGAGCTCCAGGAGAACTTATCTCGAGATAAGTTCTCCTGGAGCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025061.3-2968s21c1
Sequence:CCGGTCCGAACAATGGTTCTCATTTCTCGAGAAATGAGAACCATTGTTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025061.3-246s1c1
Sequence:CCGGCAGGACAAGATCATCTGTCTACTCGAGTAGACAGATGATCTTGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028175
LRRC8E MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 8 family, member E
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1240s1c1
Sequence:CCGGGAACGATATCCCGGATGTTAACTCGAGTTAACATCCGGGATATCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1796s1c1
Sequence:CCGGGTACTGTCTCTACGTAGCAATCTCGAGATTGCTACGTAGAGACAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1118s1c1
Sequence:CCGGGCCTTCTGCTATATTTCCTTTCTCGAGAAAGGAAATATAGCAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1637s1c1
Sequence:CCGGCTGAAGGTGATCTGTGTTAAACTCGAGTTTAACACAGATCACCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028175.1-2843s1c1
Sequence:CCGGCTCTGAACATTCTGGCTTAATCTCGAGATTAAGCCAGAATGTTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-2326s1c1
Sequence:CCGGCGATGAATTGTTCTTCTGCCACTCGAGTGGCAGAAGAACAATTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-472s1c1
Sequence:CCGGCCAGCAGTATAGCTTTATCAACTCGAGTTGATAAAGCTATACTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028175
LRRC8E MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 8 family, member E
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1240s1c1
Sequence:CCGGGAACGATATCCCGGATGTTAACTCGAGTTAACATCCGGGATATCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1796s1c1
Sequence:CCGGGTACTGTCTCTACGTAGCAATCTCGAGATTGCTACGTAGAGACAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1118s1c1
Sequence:CCGGGCCTTCTGCTATATTTCCTTTCTCGAGAAAGGAAATATAGCAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1637s1c1
Sequence:CCGGCTGAAGGTGATCTGTGTTAAACTCGAGTTTAACACAGATCACCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028175.1-2843s1c1
Sequence:CCGGCTCTGAACATTCTGGCTTAATCTCGAGATTAAGCCAGAATGTTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-2326s1c1
Sequence:CCGGCGATGAATTGTTCTTCTGCCACTCGAGTGGCAGAAGAACAATTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-472s1c1
Sequence:CCGGCCAGCAGTATAGCTTTATCAACTCGAGTTGATAAAGCTATACTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028175
LRRC8E MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 8 family, member E
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1240s1c1
Sequence:CCGGGAACGATATCCCGGATGTTAACTCGAGTTAACATCCGGGATATCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1796s1c1
Sequence:CCGGGTACTGTCTCTACGTAGCAATCTCGAGATTGCTACGTAGAGACAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1118s1c1
Sequence:CCGGGCCTTCTGCTATATTTCCTTTCTCGAGAAAGGAAATATAGCAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-1637s1c1
Sequence:CCGGCTGAAGGTGATCTGTGTTAAACTCGAGTTTAACACAGATCACCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028175.1-2843s1c1
Sequence:CCGGCTCTGAACATTCTGGCTTAATCTCGAGATTAAGCCAGAATGTTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-2326s1c1
Sequence:CCGGCGATGAATTGTTCTTCTGCCACTCGAGTGGCAGAAGAACAATTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028175.1-472s1c1
Sequence:CCGGCCAGCAGTATAGCTTTATCAACTCGAGTTGATAAAGCTATACTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)