EMAIL THIS PAGE TO A FRIEND

LRRC9

leucine rich repeat containing 9

88 Gene Product Result for
UniProtKB ID: Q6ZRR7
Gene ID:
Mouse(78257) leucine rich repeat containing 9
Rat(299129) leucine rich repeat containing 9
naked mole-rat(101723046) leucine rich repeat containing 9
Zebrafish(100135428) leucine rich repeat containing 9
chicken(423529) leucine rich repeat containing 9
cow(537580) leucine rich repeat containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198499 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_037325 Rosetta Predictions human pricing
XR_037615 Rosetta Predictions human pricing
XR_037889 Rosetta Predictions human pricing
XM_001077512 Rosetta Predictions rat pricing
XM_001077534 Rosetta Predictions rat pricing
XM_001077551 Rosetta Predictions rat pricing
XM_216733 Rosetta Predictions rat pricing
NM_030070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00501061 predicted 3863
2 SASI_Hs02_00501062 predicted 1864
3 SASI_Hs02_00501063 predicted 2690
4 SASI_Hs02_00501064 predicted 3184
5 SASI_Hs02_00501065 predicted 3217
6 SASI_Hs02_00501066 predicted 1858
7 SASI_Hs02_00501067 predicted 1139
8 SASI_Hs02_00501068 predicted 1277
9 SASI_Hs02_00501069 predicted 1054
10 SASI_Hs02_00501070 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00502527 predicted 3871
2 SASI_Hs02_00502528 predicted 1863
3 SASI_Hs02_00502529 predicted 2684
4 SASI_Hs02_00502530 predicted 3184
5 SASI_Hs02_00502531 predicted 3217
6 SASI_Hs02_00502532 predicted 1858
7 SASI_Hs02_00502533 predicted 1140
8 SASI_Hs02_00502534 predicted 1286
9 SASI_Hs02_00502535 predicted 1057
10 SASI_Hs02_00502536 predicted 1845
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00503772 predicted 3868
2 SASI_Hs02_00503773 predicted 1863
3 SASI_Hs02_00503774 predicted 2686
4 SASI_Hs02_00503775 predicted 3184
5 SASI_Hs02_00503776 predicted 3211
6 SASI_Hs02_00503777 predicted 1858
7 SASI_Hs02_00503778 predicted 1138
8 SASI_Hs02_00503779 predicted 1278
9 SASI_Hs02_00503780 predicted 1053
10 SASI_Hs02_00503781 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357345 predicted 3216
2 SASI_Rn02_00357346 predicted 3159
3 SASI_Rn02_00357347 predicted 2388
4 SASI_Rn02_00357348 predicted 870
5 SASI_Rn02_00357349 predicted 2182
6 SASI_Rn02_00357350 predicted 2037
7 SASI_Rn02_00357351 predicted 4225
8 SASI_Rn02_00357352 predicted 3925
9 SASI_Rn02_00357353 predicted 2986
10 SASI_Rn02_00357354 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357446 predicted 3125
2 SASI_Rn02_00357447 predicted 3087
3 SASI_Rn02_00357448 predicted 1517
4 SASI_Rn02_00357449 predicted 1930
5 SASI_Rn02_00357450 predicted 3031
6 SASI_Rn02_00357451 predicted 2263
7 SASI_Rn02_00357452 predicted 738
8 SASI_Rn02_00357453 predicted 1496
9 SASI_Rn02_00357454 predicted 2058
10 SASI_Rn02_00357455 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357524 predicted 3241
2 SASI_Rn02_00357525 predicted 3211
3 SASI_Rn02_00357526 predicted 1629
4 SASI_Rn02_00357527 predicted 2042
5 SASI_Rn02_00357528 predicted 3153
6 SASI_Rn02_00357529 predicted 2384
7 SASI_Rn02_00357530 predicted 856
8 SASI_Rn02_00357531 predicted 1619
9 SASI_Rn02_00357532 predicted 2181
10 SASI_Rn02_00357533 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376807 predicted 2965
2 SASI_Rn02_00376808 predicted 2933
3 SASI_Rn02_00376809 predicted 200
4 SASI_Rn02_00376810 predicted 1357
5 SASI_Rn02_00376811 predicted 1776
6 SASI_Rn02_00376812 predicted 2880
7 SASI_Rn02_00376813 predicted 667
8 SASI_Rn02_00376814 predicted 590
9 SASI_Rn02_00376815 predicted 1344
10 SASI_Rn02_00376816 predicted 1902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118782 predicted 3287
2 SASI_Mm02_00336456 predicted 2348
3 SASI_Mm02_00336457 predicted 2767
4 SASI_Mm01_00118784 predicted 2664
5 SASI_Mm01_00118786 predicted 2757
6 SASI_Mm01_00118787 predicted 1628
7 SASI_Mm01_00118788 predicted 2300
8 SASI_Mm01_00118789 predicted 3205
9 SASI_Mm01_00118790 predicted 2972
10 SASI_Mm01_00118791 predicted 947
11 SASI_Mm01_00118783 predicted 713
12 SASI_Mm01_00118785 predicted 2111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198499
LRRC9 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-679s1c1
Sequence:CCGGCGATGTCTTGACTCCAATGAACTCGAGTTCATTGGAGTCAAGACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-768s1c1
Sequence:CCGGGCTGCCTTGCTTAAAGGATTTCTCGAGAAATCCTTTAAGCAAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160921    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198499.1-3820s1c1
Sequence:CCGGGCCTCCAATAATGCACAGTTTCTCGAGAAACTGTGCATTATTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1205s1c1
Sequence:CCGGCAAGTCTTCAACAGAAGATATCTCGAGATATCTTCTGTTGAAGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-2409s1c1
Sequence:CCGGCCACTTGTATAACCTTGAATACTCGAGTATTCAAGGTTATACAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1916s1c1
Sequence:CCGGCCAACTATCCAATGGTTAATTCTCGAGAATTAACCATTGGATAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-2623s1c1
Sequence:CCGGCTGAGTGTTATTGGCAGATTACTCGAGTAATCTGCCAATAACACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1204s1c1
Sequence:CCGGCCAAGTCTTCAACAGAAGATACTCGAGTATCTTCTGTTGAAGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198499
LRRC9 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-679s1c1
Sequence:CCGGCGATGTCTTGACTCCAATGAACTCGAGTTCATTGGAGTCAAGACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-768s1c1
Sequence:CCGGGCTGCCTTGCTTAAAGGATTTCTCGAGAAATCCTTTAAGCAAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160921    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198499.1-3820s1c1
Sequence:CCGGGCCTCCAATAATGCACAGTTTCTCGAGAAACTGTGCATTATTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1205s1c1
Sequence:CCGGCAAGTCTTCAACAGAAGATATCTCGAGATATCTTCTGTTGAAGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-2409s1c1
Sequence:CCGGCCACTTGTATAACCTTGAATACTCGAGTATTCAAGGTTATACAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1916s1c1
Sequence:CCGGCCAACTATCCAATGGTTAATTCTCGAGAATTAACCATTGGATAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-2623s1c1
Sequence:CCGGCTGAGTGTTATTGGCAGATTACTCGAGTAATCTGCCAATAACACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1204s1c1
Sequence:CCGGCCAAGTCTTCAACAGAAGATACTCGAGTATCTTCTGTTGAAGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198499
LRRC9 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-679s1c1
Sequence:CCGGCGATGTCTTGACTCCAATGAACTCGAGTTCATTGGAGTCAAGACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-768s1c1
Sequence:CCGGGCTGCCTTGCTTAAAGGATTTCTCGAGAAATCCTTTAAGCAAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160921    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198499.1-3820s1c1
Sequence:CCGGGCCTCCAATAATGCACAGTTTCTCGAGAAACTGTGCATTATTGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1205s1c1
Sequence:CCGGCAAGTCTTCAACAGAAGATATCTCGAGATATCTTCTGTTGAAGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-2409s1c1
Sequence:CCGGCCACTTGTATAACCTTGAATACTCGAGTATTCAAGGTTATACAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1916s1c1
Sequence:CCGGCCAACTATCCAATGGTTAATTCTCGAGAATTAACCATTGGATAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-2623s1c1
Sequence:CCGGCTGAGTGTTATTGGCAGATTACTCGAGTAATCTGCCAATAACACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198499.1-1204s1c1
Sequence:CCGGCCAAGTCTTCAACAGAAGATACTCGAGTATCTTCTGTTGAAGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030070
LRRC9 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1953s1c1
Sequence:CCGGCCCATCAATAAAGCCAACTATCTCGAGATAGTTGGCTTTATTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1550s1c1
Sequence:CCGGGCGGGTCATTAAAGTCAACAACTCGAGTTGTTGACTTTAATGACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-2085s1c1
Sequence:CCGGCCAGAGTACATCGTTGAATTTCTCGAGAAATTCAACGATGTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1952s1c1
Sequence:CCGGGCCCATCAATAAAGCCAACTACTCGAGTAGTTGGCTTTATTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-456s1c1
Sequence:CCGGGCTCAAGATATAAGGGAAATTCTCGAGAATTTCCCTTATATCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030070
LRRC9 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1953s1c1
Sequence:CCGGCCCATCAATAAAGCCAACTATCTCGAGATAGTTGGCTTTATTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1550s1c1
Sequence:CCGGGCGGGTCATTAAAGTCAACAACTCGAGTTGTTGACTTTAATGACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-2085s1c1
Sequence:CCGGCCAGAGTACATCGTTGAATTTCTCGAGAAATTCAACGATGTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1952s1c1
Sequence:CCGGGCCCATCAATAAAGCCAACTACTCGAGTAGTTGGCTTTATTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-456s1c1
Sequence:CCGGGCTCAAGATATAAGGGAAATTCTCGAGAATTTCCCTTATATCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030070
LRRC9 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1953s1c1
Sequence:CCGGCCCATCAATAAAGCCAACTATCTCGAGATAGTTGGCTTTATTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1550s1c1
Sequence:CCGGGCGGGTCATTAAAGTCAACAACTCGAGTTGTTGACTTTAATGACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-2085s1c1
Sequence:CCGGCCAGAGTACATCGTTGAATTTCTCGAGAAATTCAACGATGTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-1952s1c1
Sequence:CCGGGCCCATCAATAAAGCCAACTACTCGAGTAGTTGGCTTTATTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030070.1-456s1c1
Sequence:CCGGGCTCAAGATATAAGGGAAATTCTCGAGAATTTCCCTTATATCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)