EMAIL THIS PAGE TO A FRIEND

LRRCC1

leucine rich repeat and coiled-coil centrosomal protein 1

76 Gene Product Result for
Synonyms: CLERC SAP2 VFL1
UniProtKB ID: Q9C099, B4DYX6, B5RI11, Q8N768, Q96DK7, Q96N01
Gene ID:
Mouse(71710) leucine rich repeat and coiled-coil domain containing 1
Rat(266808) leucine rich repeat and coiled-coil centrosomal protein 1
Zebrafish(561887) leucine rich repeat and coiled-coil domain containing 1
dog(487028) leucine rich repeat and coiled-coil centrosomal protein 1
domestic cat(101093492) leucine rich repeat and coiled-coil centrosomal protein 1
cow(787651) leucine rich repeat and coiled-coil domain containing 1
Horse(100056179) leucine rich repeat and coiled-coil centrosomal protein 1
chicken(420205) leucine rich repeat and coiled-coil centrosomal protein 1
sheep(101118707) leucine rich repeat and coiled-coil centrosomal protein 1
naked mole-rat(101714696) leucine rich repeat and coiled-coil centrosomal protein 1
Domestic Rabbit(100348304) leucine rich repeat and coiled-coil centrosomal protein 1
domestic guinea pig(100719472) leucine rich repeat and coiled-coil centrosomal protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033402 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077501 Rosetta Predictions human pricing
NM_033402 Rosetta Predictions human pricing
XM_001054030 Rosetta Predictions rat pricing
XM_342209 Rosetta Predictions rat pricing
NM_028915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312864 predicted 2018
2 SASI_Hs02_00312865 predicted 2365
3 SASI_Hs02_00312866 predicted 922
4 SASI_Hs02_00312867 predicted 720
5 SASI_Hs02_00312868 predicted 2211
6 SASI_Hs02_00312869 predicted 1871
7 SASI_Hs02_00312870 predicted 1952
8 SASI_Hs02_00312871 predicted 2313
9 SASI_Hs02_00312872 predicted 651
10 SASI_Hs02_00312873 predicted 2158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049319 predicted 2218
2 SASI_Hs02_00361282 predicted 1137
3 SASI_Hs02_00361283 predicted 931
4 SASI_Hs01_00049324 predicted 2422
5 SASI_Hs02_00361284 predicted 3251
6 SASI_Hs01_00049325 predicted 2073
7 SASI_Hs01_00049326 predicted 2160
8 SASI_Hs02_00361285 predicted 865
9 SASI_Hs01_00049327 predicted 2360
10 SASI_Hs01_00049328 predicted 733
11 SASI_Hs01_00049320 predicted 528
12 SASI_Hs01_00049321 predicted 421
13 SASI_Hs01_00049322 predicted 462
14 SASI_Hs01_00049323 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274402 predicted 1768
2 SASI_Rn02_00274403 predicted 664
3 SASI_Rn02_00274404 predicted 616
4 SASI_Rn02_00274405 predicted 518
5 SASI_Rn02_00274406 predicted 376
6 SASI_Rn02_00274407 predicted 961
7 SASI_Rn02_00274408 predicted 1384
8 SASI_Rn02_00274409 predicted 629
9 SASI_Rn02_00274410 predicted 602
10 SASI_Rn02_00274411 predicted 1900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393916 predicted 269
2 SASI_Rn02_00393917 predicted 230
3 SASI_Rn02_00393918 predicted 229
4 SASI_Rn02_00393919 predicted 271
5 SASI_Rn02_00393920 predicted 266
6 SASI_Rn02_00393921 predicted 214
7 SASI_Rn02_00393922 predicted 238
8 SASI_Rn02_00393923 predicted 259
9 SASI_Rn02_00393924 predicted 200
10 SASI_Rn02_00393925 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049382 predicted 1339
2 SASI_Mm01_00049383 predicted 1940
3 SASI_Mm01_00049384 predicted 230
4 SASI_Mm01_00049385 predicted 581
5 SASI_Mm01_00049387 predicted 1291
6 SASI_Mm01_00049388 predicted 438
7 SASI_Mm01_00049389 predicted 2394
8 SASI_Mm01_00049390 predicted 1627
9 SASI_Mm02_00334594 predicted 1314
10 SASI_Mm01_00049391 predicted 2053
11 SASI_Mm01_00049386 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033402
LRRCC1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and coiled-coil centrosomal protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-1609s21c1
Sequence:CCGGCAAAGGACAACTCGAAGTTATCTCGAGATAACTTCGAGTTGTCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-480s21c1
Sequence:CCGGTTAATCTGACTAGACTAAATGCTCGAGCATTTAGTCTAGTCAGATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-2073s1c1
Sequence:CCGGCAAAGAGCAAACATGCTCTTACTCGAGTAAGAGCATGTTTGCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-2018s1c1
Sequence:CCGGGCCAGAAGATTTCAAGATGTTCTCGAGAACATCTTGAAATCTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033402.2-2716s1c1
Sequence:CCGGCAACAGTTGAAAGGAAAGGAACTCGAGTTCCTTTCCTTTCAACTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-327s21c1
Sequence:CCGGTCGAAGCCATTGATCATATTTCTCGAGAAATATGATCAATGGCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-1561s21c1
Sequence:CCGGACTTACCACAGATAGGCTAAACTCGAGTTTAGCCTATCTGTGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-1325s1c1
Sequence:CCGGGACAACACTTACCAGTCCCTTCTCGAGAAGGGACTGGTAAGTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033402.2-2962s1c1
Sequence:CCGGGCAATTGTTGAAGCTCATCAACTCGAGTTGATGAGCTTCAACAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033402
LRRCC1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and coiled-coil centrosomal protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-1609s21c1
Sequence:CCGGCAAAGGACAACTCGAAGTTATCTCGAGATAACTTCGAGTTGTCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-480s21c1
Sequence:CCGGTTAATCTGACTAGACTAAATGCTCGAGCATTTAGTCTAGTCAGATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-2073s1c1
Sequence:CCGGCAAAGAGCAAACATGCTCTTACTCGAGTAAGAGCATGTTTGCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-2018s1c1
Sequence:CCGGGCCAGAAGATTTCAAGATGTTCTCGAGAACATCTTGAAATCTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033402.2-2716s1c1
Sequence:CCGGCAACAGTTGAAAGGAAAGGAACTCGAGTTCCTTTCCTTTCAACTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-327s21c1
Sequence:CCGGTCGAAGCCATTGATCATATTTCTCGAGAAATATGATCAATGGCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-1561s21c1
Sequence:CCGGACTTACCACAGATAGGCTAAACTCGAGTTTAGCCTATCTGTGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-1325s1c1
Sequence:CCGGGACAACACTTACCAGTCCCTTCTCGAGAAGGGACTGGTAAGTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033402.2-2962s1c1
Sequence:CCGGGCAATTGTTGAAGCTCATCAACTCGAGTTGATGAGCTTCAACAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033402
LRRCC1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and coiled-coil centrosomal protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-1609s21c1
Sequence:CCGGCAAAGGACAACTCGAAGTTATCTCGAGATAACTTCGAGTTGTCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-480s21c1
Sequence:CCGGTTAATCTGACTAGACTAAATGCTCGAGCATTTAGTCTAGTCAGATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-2073s1c1
Sequence:CCGGCAAAGAGCAAACATGCTCTTACTCGAGTAAGAGCATGTTTGCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-2018s1c1
Sequence:CCGGGCCAGAAGATTTCAAGATGTTCTCGAGAACATCTTGAAATCTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033402.2-2716s1c1
Sequence:CCGGCAACAGTTGAAAGGAAAGGAACTCGAGTTCCTTTCCTTTCAACTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-327s21c1
Sequence:CCGGTCGAAGCCATTGATCATATTTCTCGAGAAATATGATCAATGGCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033402.3-1561s21c1
Sequence:CCGGACTTACCACAGATAGGCTAAACTCGAGTTTAGCCTATCTGTGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033402.2-1325s1c1
Sequence:CCGGGACAACACTTACCAGTCCCTTCTCGAGAAGGGACTGGTAAGTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033402.2-2962s1c1
Sequence:CCGGGCAATTGTTGAAGCTCATCAACTCGAGTTGATGAGCTTCAACAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028915
LRRCC1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and coiled-coil centrosomal protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028915.1-3181s1c1
Sequence:CCGGGCTTCTGAGAGCTTGGACTAACTCGAGTTAGTCCAAGCTCTCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-2269s1c1
Sequence:CCGGGCAGCCAATTTACAGAATCAACTCGAGTTGATTCTGTAAATTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-2134s1c1
Sequence:CCGGGCGAAGAGTAAACATGCTCTTCTCGAGAAGAGCATGTTTACTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-1275s1c1
Sequence:CCGGGCCTTACCTTAGAGATTTATACTCGAGTATAAATCTCTAAGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-612s1c1
Sequence:CCGGGCACTTCCTAACCAATCTTATCTCGAGATAAGATTGGTTAGGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028915
LRRCC1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and coiled-coil centrosomal protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028915.1-3181s1c1
Sequence:CCGGGCTTCTGAGAGCTTGGACTAACTCGAGTTAGTCCAAGCTCTCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-2269s1c1
Sequence:CCGGGCAGCCAATTTACAGAATCAACTCGAGTTGATTCTGTAAATTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-2134s1c1
Sequence:CCGGGCGAAGAGTAAACATGCTCTTCTCGAGAAGAGCATGTTTACTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-1275s1c1
Sequence:CCGGGCCTTACCTTAGAGATTTATACTCGAGTATAAATCTCTAAGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-612s1c1
Sequence:CCGGGCACTTCCTAACCAATCTTATCTCGAGATAAGATTGGTTAGGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028915
LRRCC1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and coiled-coil centrosomal protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028915.1-3181s1c1
Sequence:CCGGGCTTCTGAGAGCTTGGACTAACTCGAGTTAGTCCAAGCTCTCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-2269s1c1
Sequence:CCGGGCAGCCAATTTACAGAATCAACTCGAGTTGATTCTGTAAATTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-2134s1c1
Sequence:CCGGGCGAAGAGTAAACATGCTCTTCTCGAGAAGAGCATGTTTACTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-1275s1c1
Sequence:CCGGGCCTTACCTTAGAGATTTATACTCGAGTATAAATCTCTAAGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028915.1-612s1c1
Sequence:CCGGGCACTTCCTAACCAATCTTATCTCGAGATAAGATTGGTTAGGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)