EMAIL THIS PAGE TO A FRIEND

LRRD1

leucine-rich repeats and death domain containing 1

60 Gene Product Result for
UniProtKB ID: A4D1F6, B7ZMM9, Q49AT9
Gene ID:
Mouse(242838) leucine rich repeats and death domain containing 1
Rat(296836) leucine-rich repeats and death domain containing 1
domestic guinea pig(100717212) leucine-rich repeats and death domain containing 1
naked mole-rat(101699651) leucine-rich repeats and death domain containing 1
sheep(101110226) leucine-rich repeats and death domain containing 1
Horse(100061098) leucine-rich repeats and death domain containing 1
cow(784825) leucine-rich repeats and death domain containing 1
domestic cat(101085790) leucine-rich repeats and death domain containing 1
dog(482296) leucine-rich repeats and death domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001161528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001161528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001161528 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004741 MISSION® esiRNA esiRNA targeting mouse 4932412H11Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_934383 Rosetta Predictions human pricing
XM_934385 Rosetta Predictions human pricing
XM_001068373 Rosetta Predictions rat pricing
XM_216085 Rosetta Predictions rat pricing
NM_172879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262899 predicted 559
2 SASI_Hs01_00262900 predicted 651
3 SASI_Hs01_00262901 predicted 658
4 SASI_Hs01_00262902 predicted 557
5 SASI_Hs01_00262903 predicted 632
6 SASI_Hs01_00262904 predicted 631
7 SASI_Hs01_00262905 predicted 571
8 SASI_Hs01_00262906 predicted 561
9 SASI_Hs01_00262907 predicted 554
10 SASI_Hs01_00262908 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249875 predicted 552
2 SASI_Hs01_00249876 predicted 648
3 SASI_Hs01_00249877 predicted 632
4 SASI_Hs01_00249878 predicted 669
5 SASI_Hs01_00249879 predicted 551
6 SASI_Hs01_00249880 predicted 653
7 SASI_Hs01_00249881 predicted 671
8 SASI_Hs01_00249882 predicted 630
9 SASI_Hs01_00249883 predicted 645
10 SASI_Hs01_00249884 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324330 predicted 438
2 SASI_Rn02_00324331 predicted 1159
3 SASI_Rn02_00324332 predicted 1911
4 SASI_Rn02_00324333 predicted 336
5 SASI_Rn02_00324334 predicted 644
6 SASI_Rn02_00324335 predicted 1718
7 SASI_Rn02_00324336 predicted 1302
8 SASI_Rn02_00324337 predicted 1926
9 SASI_Rn02_00324338 predicted 412
10 SASI_Rn02_00324339 predicted 1965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376420 predicted 439
2 SASI_Rn02_00376421 predicted 1166
3 SASI_Rn02_00376422 predicted 1918
4 SASI_Rn02_00376423 predicted 338
5 SASI_Rn02_00376424 predicted 647
6 SASI_Rn02_00376425 predicted 1719
7 SASI_Rn02_00376426 predicted 1302
8 SASI_Rn02_00376427 predicted 1925
9 SASI_Rn02_00376428 predicted 412
10 SASI_Rn02_00376429 predicted 1965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344848 predicted 2442
2 SASI_Mm01_00099919 predicted 1860
3 SASI_Mm01_00099920 predicted 999
4 SASI_Mm01_00099921 predicted 972
5 SASI_Mm01_00099922 predicted 777
6 SASI_Mm01_00099923 predicted 1047
7 SASI_Mm01_00099924 predicted 721
8 SASI_Mm02_00344849 predicted 700
9 SASI_Mm01_00099926 predicted 572
10 SASI_Mm01_00099927 predicted 1173
11 SASI_Mm01_00099918 predicted 1772
12 SASI_Mm01_00099925 predicted 1907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001161528
LRRD1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and death domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1262s21c1
Sequence:CCGGGTTGGAATGCCTTAGTCTTAGCTCGAGCTAAGACTAAGGCATTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1741s21c1
Sequence:CCGGTATCACTCCACGTACTTATTTCTCGAGAAATAAGTACGTGGAGTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-893s21c1
Sequence:CCGGAGATACTCTGCCTAGTTTAAACTCGAGTTTAAACTAGGCAGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-101s21c1
Sequence:CCGGAGTGCTAGAGGATACTATTAGCTCGAGCTAATAGTATCCTCTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-731s21c1
Sequence:CCGGTCATAACCACATATCACATATCTCGAGATATGTGATATGTGGTTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1301s21c1
Sequence:CCGGACTCCCTAAGTACATCCATAACTCGAGTTATGGATGTACTTAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-2211s21c1
Sequence:CCGGCCTAGTGCTATCTACAATATTCTCGAGAATATTGTAGATAGCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001161528
LRRD1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and death domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1262s21c1
Sequence:CCGGGTTGGAATGCCTTAGTCTTAGCTCGAGCTAAGACTAAGGCATTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1741s21c1
Sequence:CCGGTATCACTCCACGTACTTATTTCTCGAGAAATAAGTACGTGGAGTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-893s21c1
Sequence:CCGGAGATACTCTGCCTAGTTTAAACTCGAGTTTAAACTAGGCAGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-101s21c1
Sequence:CCGGAGTGCTAGAGGATACTATTAGCTCGAGCTAATAGTATCCTCTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-731s21c1
Sequence:CCGGTCATAACCACATATCACATATCTCGAGATATGTGATATGTGGTTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1301s21c1
Sequence:CCGGACTCCCTAAGTACATCCATAACTCGAGTTATGGATGTACTTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-2211s21c1
Sequence:CCGGCCTAGTGCTATCTACAATATTCTCGAGAATATTGTAGATAGCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001161528
LRRD1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and death domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1262s21c1
Sequence:CCGGGTTGGAATGCCTTAGTCTTAGCTCGAGCTAAGACTAAGGCATTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1741s21c1
Sequence:CCGGTATCACTCCACGTACTTATTTCTCGAGAAATAAGTACGTGGAGTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-893s21c1
Sequence:CCGGAGATACTCTGCCTAGTTTAAACTCGAGTTTAAACTAGGCAGAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-101s21c1
Sequence:CCGGAGTGCTAGAGGATACTATTAGCTCGAGCTAATAGTATCCTCTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-731s21c1
Sequence:CCGGTCATAACCACATATCACATATCTCGAGATATGTGATATGTGGTTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-1301s21c1
Sequence:CCGGACTCCCTAAGTACATCCATAACTCGAGTTATGGATGTACTTAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161528.1-2211s21c1
Sequence:CCGGCCTAGTGCTATCTACAATATTCTCGAGAATATTGTAGATAGCACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172879
LRRD1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and death domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-743s1c1
Sequence:CCGGCTGATAACTTTACAGTTAATCCTCGAGGATTAACTGTAAAGTTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-796s1c1
Sequence:CCGGGACATTGTCAAAGTCAAATATCTCGAGATATTTGACTTTGACAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-2014s1c1
Sequence:CCGGGATAATAAGTTCGAGAGTTTCCTCGAGGAAACTCTCGAACTTATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-1721s1c1
Sequence:CCGGCAAGAGTTGAACTGAATTATACTCGAGTATAATTCAGTTCAACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-532s1c1
Sequence:CCGGGCTTGATAGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCTATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-1001s1c1
Sequence:CCGGCCCAAAGAACTACTACAACTTCTCGAGAAGTTGTAGTAGTTCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-2718s1c1
Sequence:CCGGCCACTACTCCATTAAATGAAACTCGAGTTTCATTTAATGGAGTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-2460s1c1
Sequence:CCGGCCAGTGGTATCTACAAACTTTCTCGAGAAAGTTTGTAGATACCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-1312s1c1
Sequence:CCGGCCTTCTAATGGATCACAATAACTCGAGTTATTGTGATCCATTAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.1-533s1c1
Sequence:CCGGCTTGATAGAAACGAAGAGAAACTCGAGTTTCTCTTCGTTTCTATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172879
LRRD1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and death domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-743s1c1
Sequence:CCGGCTGATAACTTTACAGTTAATCCTCGAGGATTAACTGTAAAGTTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-796s1c1
Sequence:CCGGGACATTGTCAAAGTCAAATATCTCGAGATATTTGACTTTGACAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-2014s1c1
Sequence:CCGGGATAATAAGTTCGAGAGTTTCCTCGAGGAAACTCTCGAACTTATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-1721s1c1
Sequence:CCGGCAAGAGTTGAACTGAATTATACTCGAGTATAATTCAGTTCAACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-532s1c1
Sequence:CCGGGCTTGATAGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCTATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-1001s1c1
Sequence:CCGGCCCAAAGAACTACTACAACTTCTCGAGAAGTTGTAGTAGTTCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-2718s1c1
Sequence:CCGGCCACTACTCCATTAAATGAAACTCGAGTTTCATTTAATGGAGTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-2460s1c1
Sequence:CCGGCCAGTGGTATCTACAAACTTTCTCGAGAAAGTTTGTAGATACCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-1312s1c1
Sequence:CCGGCCTTCTAATGGATCACAATAACTCGAGTTATTGTGATCCATTAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.1-533s1c1
Sequence:CCGGCTTGATAGAAACGAAGAGAAACTCGAGTTTCTCTTCGTTTCTATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172879
LRRD1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and death domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-743s1c1
Sequence:CCGGCTGATAACTTTACAGTTAATCCTCGAGGATTAACTGTAAAGTTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-796s1c1
Sequence:CCGGGACATTGTCAAAGTCAAATATCTCGAGATATTTGACTTTGACAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-2014s1c1
Sequence:CCGGGATAATAAGTTCGAGAGTTTCCTCGAGGAAACTCTCGAACTTATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.3-1721s1c1
Sequence:CCGGCAAGAGTTGAACTGAATTATACTCGAGTATAATTCAGTTCAACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-532s1c1
Sequence:CCGGGCTTGATAGAAACGAAGAGAACTCGAGTTCTCTTCGTTTCTATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-1001s1c1
Sequence:CCGGCCCAAAGAACTACTACAACTTCTCGAGAAGTTGTAGTAGTTCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-2718s1c1
Sequence:CCGGCCACTACTCCATTAAATGAAACTCGAGTTTCATTTAATGGAGTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-2460s1c1
Sequence:CCGGCCAGTGGTATCTACAAACTTTCTCGAGAAAGTTTGTAGATACCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172879.1-1312s1c1
Sequence:CCGGCCTTCTAATGGATCACAATAACTCGAGTTATTGTGATCCATTAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172879.1-533s1c1
Sequence:CCGGCTTGATAGAAACGAAGAGAAACTCGAGTTTCTCTTCGTTTCTATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)