EMAIL THIS PAGE TO A FRIEND

LRRFIP1

leucine rich repeat (in FLII) interacting protein 1

167 Gene Product Result for
Synonyms: FLAP-1 FLAP1 FLIIAP1 GCF-2 GCF2 HUFI-1 TRIP
Gene ID:
Mouse(16978) leucine rich repeat (in FLII) interacting protein 1
Rat(367314) leucine rich repeat (in FLII) interacting protein 1
chicken(428996) leucine rich repeat (in FLII) interacting protein 1
cow(616994) leucine rich repeat (in FLII) interacting protein 1
Horse(100066467) leucine rich repeat (in FLII) interacting protein 1
domestic cat(101081825) leucine rich repeat (in FLII) interacting protein 1
dog(477419) leucine rich repeat (in FLII) interacting protein 1
sheep(101101844) leucine rich repeat (in FLII) interacting protein 1
naked mole-rat(101700543) leucine rich repeat (in FLII) interacting protein 1
domestic guinea pig(100729001) leucine rich repeat (in FLII) interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004735 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099251 MISSION® esiRNA esiRNA human LRRFIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004735 Rosetta Predictions human pricing
NM_001014269 Rosetta Predictions rat pricing
NM_001111311 Rosetta Predictions mouse pricing
NM_001111312 Rosetta Predictions mouse pricing
NM_008515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104978 predicted 2357
2 SASI_Hs01_00104979 predicted 2409
3 SASI_Hs01_00104980 predicted 1246
4 SASI_Hs01_00104981 predicted 1111
5 SASI_Hs01_00104982 predicted 1422
6 SASI_Hs02_00338215 predicted 843
7 SASI_Hs01_00104983 predicted 2588
8 SASI_Hs01_00104984 predicted 1193
9 SASI_Hs01_00104985 predicted 841
10 SASI_Hs01_00104986 predicted 656
11 SASI_Hs01_00104987 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077625 predicted 746
2 SASI_Rn01_00077626 predicted 783
3 SASI_Rn01_00077627 predicted 1558
4 SASI_Rn01_00077628 predicted 1001
5 SASI_Rn02_00201841 predicted 1169
6 SASI_Rn01_00077629 predicted 2323
7 SASI_Rn01_00077630 predicted 1287
8 SASI_Rn01_00077631 predicted 1293
9 SASI_Rn01_00077632 predicted 2189
10 SASI_Rn01_00077633 predicted 2232
11 SASI_Rn01_00077634 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306755 predicted 831
2 SASI_Mm02_00306756 predicted 1524
3 SASI_Mm02_00306757 predicted 1231
4 SASI_Mm02_00306758 predicted 1524
5 SASI_Mm02_00306759 predicted 1066
6 SASI_Mm02_00306760 predicted 1527
7 SASI_Mm02_00306761 predicted 2334
8 SASI_Mm02_00306762 predicted 669
9 SASI_Mm02_00306763 predicted 797
10 SASI_Mm02_00306764 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306765 predicted 1111
2 SASI_Mm02_00306766 predicted 1346
3 SASI_Mm02_00306767 predicted 1070
4 SASI_Mm02_00306768 predicted 1833
5 SASI_Mm02_00306769 predicted 1561
6 SASI_Mm02_00306770 predicted 1332
7 SASI_Mm02_00306771 predicted 1239
8 SASI_Mm02_00306772 predicted 1685
9 SASI_Mm02_00306773 predicted 1072
10 SASI_Mm02_00306774 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314078 predicted 1853
2 SASI_Mm02_00314079 predicted 2090
3 SASI_Mm02_00314080 predicted 1812
4 SASI_Mm02_00314081 predicted 2581
5 SASI_Mm02_00314082 predicted 2304
6 SASI_Mm01_00070379 predicted 2078
7 SASI_Mm02_00314083 predicted 1984
8 SASI_Mm02_00314084 predicted 2428
9 SASI_Mm02_00314085 predicted 1814
10 SASI_Mm02_00314086 predicted 1803
11 SASI_Mm01_00070373 predicted 1476
12 SASI_Mm01_00070374 predicted 904
13 SASI_Mm01_00070375 predicted 1363
14 SASI_Mm01_00070376 predicted 479
15 SASI_Mm01_00070377 predicted 474
16 SASI_Mm01_00070378 predicted 1348
17 SASI_Mm01_00070380 predicted 1437
18 SASI_Mm01_00070381 predicted 885
19 SASI_Mm01_00070382 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004735
VALIDATED
LRRFIP1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat (in FLII) interacting protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-2721s1c1
Sequence:CCGGCCCAGATTAGAAAGACATATTCTCGAGAATATGTCTTTCTAATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004735.1-349s1c1
Sequence:CCGGCTCTCGTAGATCCAGAAGAAACTCGAGTTTCTTCTGGATCTACGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1572s1c1
Sequence:CCGGCGCACAGTACAGAAGTAGGTACTCGAGTACCTACTTCTGTACTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1203s1c1
Sequence:CCGGCCTATGAAGAACAGGTTCAAACTCGAGTTTGAACCTGTTCTTCATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1709s1c1
Sequence:CCGGCCAAGTACAGTAGACACTCAACTCGAGTTGAGTGTCTACTGTACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004735
VALIDATED
LRRFIP1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat (in FLII) interacting protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-2721s1c1
Sequence:CCGGCCCAGATTAGAAAGACATATTCTCGAGAATATGTCTTTCTAATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004735.1-349s1c1
Sequence:CCGGCTCTCGTAGATCCAGAAGAAACTCGAGTTTCTTCTGGATCTACGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1572s1c1
Sequence:CCGGCGCACAGTACAGAAGTAGGTACTCGAGTACCTACTTCTGTACTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1203s1c1
Sequence:CCGGCCTATGAAGAACAGGTTCAAACTCGAGTTTGAACCTGTTCTTCATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1709s1c1
Sequence:CCGGCCAAGTACAGTAGACACTCAACTCGAGTTGAGTGTCTACTGTACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004735
VALIDATED
LRRFIP1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat (in FLII) interacting protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-2721s1c1
Sequence:CCGGCCCAGATTAGAAAGACATATTCTCGAGAATATGTCTTTCTAATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004735.1-349s1c1
Sequence:CCGGCTCTCGTAGATCCAGAAGAAACTCGAGTTTCTTCTGGATCTACGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1572s1c1
Sequence:CCGGCGCACAGTACAGAAGTAGGTACTCGAGTACCTACTTCTGTACTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1203s1c1
Sequence:CCGGCCTATGAAGAACAGGTTCAAACTCGAGTTTGAACCTGTTCTTCATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004735.1-1709s1c1
Sequence:CCGGCCAAGTACAGTAGACACTCAACTCGAGTTGAGTGTCTACTGTACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008515
VALIDATED
LRRFIP1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat (in FLII) interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-1619s1c1
Sequence:CCGGGAACAGATTAAGAAGCTCAAACTCGAGTTTGAGCTTCTTAATCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-994s1c1
Sequence:CCGGCGAAGTTGAAGAGAAGTACAACTCGAGTTGTACTTCTCTTCAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008515.1-2542s1c1
Sequence:CCGGCTAGACGTAAAGTGACCTTAACTCGAGTTAAGGTCACTTTACGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-993s1c1
Sequence:CCGGCCGAAGTTGAAGAGAAGTACACTCGAGTGTACTTCTCTTCAACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-498s1c1
Sequence:CCGGCCCAGTCCCTAAGTAGAAGATCTCGAGATCTTCTACTTAGGGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-1820s21c1
Sequence:CCGGCAGATCAGCGACCTCAAATTTCTCGAGAAATTTGAGGTCGCTGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008515.4-2595s21c1
Sequence:CCGGAGGCGATGGTCTAGACGTAAACTCGAGTTTACGTCTAGACCATCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008515.4-443s21c1
Sequence:CCGGGAGCGCTACTCTCGTAGATTCCTCGAGGAATCTACGAGAGTAGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-534s21c1
Sequence:CCGGACGGTTATGACGGAGACTATTCTCGAGAATAGTCTCCGTCATAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-1498s21c1
Sequence:CCGGACATGGAATAATCCTAAATTCCTCGAGGAATTTAGGATTATTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008515
VALIDATED
LRRFIP1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat (in FLII) interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-1619s1c1
Sequence:CCGGGAACAGATTAAGAAGCTCAAACTCGAGTTTGAGCTTCTTAATCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-994s1c1
Sequence:CCGGCGAAGTTGAAGAGAAGTACAACTCGAGTTGTACTTCTCTTCAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008515.1-2542s1c1
Sequence:CCGGCTAGACGTAAAGTGACCTTAACTCGAGTTAAGGTCACTTTACGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-993s1c1
Sequence:CCGGCCGAAGTTGAAGAGAAGTACACTCGAGTGTACTTCTCTTCAACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-498s1c1
Sequence:CCGGCCCAGTCCCTAAGTAGAAGATCTCGAGATCTTCTACTTAGGGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-1820s21c1
Sequence:CCGGCAGATCAGCGACCTCAAATTTCTCGAGAAATTTGAGGTCGCTGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008515.4-2595s21c1
Sequence:CCGGAGGCGATGGTCTAGACGTAAACTCGAGTTTACGTCTAGACCATCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008515.4-443s21c1
Sequence:CCGGGAGCGCTACTCTCGTAGATTCCTCGAGGAATCTACGAGAGTAGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-534s21c1
Sequence:CCGGACGGTTATGACGGAGACTATTCTCGAGAATAGTCTCCGTCATAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-1498s21c1
Sequence:CCGGACATGGAATAATCCTAAATTCCTCGAGGAATTTAGGATTATTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008515
VALIDATED
LRRFIP1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat (in FLII) interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-1619s1c1
Sequence:CCGGGAACAGATTAAGAAGCTCAAACTCGAGTTTGAGCTTCTTAATCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-994s1c1
Sequence:CCGGCGAAGTTGAAGAGAAGTACAACTCGAGTTGTACTTCTCTTCAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008515.1-2542s1c1
Sequence:CCGGCTAGACGTAAAGTGACCTTAACTCGAGTTAAGGTCACTTTACGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-993s1c1
Sequence:CCGGCCGAAGTTGAAGAGAAGTACACTCGAGTGTACTTCTCTTCAACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008515.1-498s1c1
Sequence:CCGGCCCAGTCCCTAAGTAGAAGATCTCGAGATCTTCTACTTAGGGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-1820s21c1
Sequence:CCGGCAGATCAGCGACCTCAAATTTCTCGAGAAATTTGAGGTCGCTGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008515.4-2595s21c1
Sequence:CCGGAGGCGATGGTCTAGACGTAAACTCGAGTTTACGTCTAGACCATCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008515.4-443s21c1
Sequence:CCGGGAGCGCTACTCTCGTAGATTCCTCGAGGAATCTACGAGAGTAGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-534s21c1
Sequence:CCGGACGGTTATGACGGAGACTATTCTCGAGAATAGTCTCCGTCATAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008515.4-1498s21c1
Sequence:CCGGACATGGAATAATCCTAAATTCCTCGAGGAATTTAGGATTATTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)