EMAIL THIS PAGE TO A FRIEND

LRRFIP2

leucine rich repeat (in FLII) interacting protein 2

174 Gene Product Result for
Synonyms: HUFI-2
UniProtKB ID: Q9Y608, A8K649, Q68CV3, Q9NXH5
Gene ID:
Mouse(71268) leucine rich repeat (in FLII) interacting protein 2
Rat(301035) leucine rich repeat (in FLII) interacting protein 2
Zebrafish(335838) leucine rich repeat (in FLII) interacting protein 2
chicken(420759) leucine rich repeat (in FLII) interacting protein 2
domestic cat(101088268) leucine rich repeat (in FLII) interacting protein 2
cow(510368) leucine rich repeat (in FLII) interacting protein 2
Horse(100050285) leucine rich repeat (in FLII) interacting protein 2
dog(485582) leucine rich repeat (in FLII) interacting protein 2
domestic guinea pig(100717012) leucine rich repeat (in FLII) interacting protein 2
naked mole-rat(101698154) leucine rich repeat (in FLII) interacting protein 2
Domestic Rabbit(100338416) leucine rich repeat (in FLII) interacting protein 2
sheep(101107739) leucine rich repeat (in FLII) interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006309 Rosetta Predictions human pricing
NM_017724 Rosetta Predictions human pricing
NM_001024761 Rosetta Predictions rat pricing
NM_027742 Rosetta Predictions mouse pricing
XM_284541 Rosetta Predictions mouse pricing
XM_895140 Rosetta Predictions mouse pricing
XM_903006 Rosetta Predictions mouse pricing
XM_903007 Rosetta Predictions mouse pricing
XM_903009 Rosetta Predictions mouse pricing
XM_903010 Rosetta Predictions mouse pricing
XM_903013 Rosetta Predictions mouse pricing
XM_903014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114986 predicted 2146
2 SASI_Hs01_00114987 predicted 1925
3 SASI_Hs01_00114988 predicted 1944
4 SASI_Hs02_00341328 predicted 1962
5 SASI_Hs01_00114989 predicted 1937
6 SASI_Hs01_00114990 predicted 1949
7 SASI_Hs01_00114991 predicted 1947
8 SASI_Hs01_00114992 predicted 2120
9 SASI_Hs01_00114993 predicted 1920
10 SASI_Hs01_00114994 predicted 1949
11 SASI_Hs01_00114995 predicted 1888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110560 predicted 1210
2 SASI_Hs01_00110561 predicted 988
3 SASI_Hs01_00110562 predicted 1004
4 SASI_Hs02_00350496 predicted 1026
5 SASI_Hs01_00110563 predicted 1001
6 SASI_Hs01_00110564 predicted 1020
7 SASI_Hs01_00110565 predicted 1006
8 SASI_Hs01_00110566 predicted 1183
9 SASI_Hs01_00110567 predicted 980
10 SASI_Hs01_00110568 predicted 1009
11 SASI_Hs01_00110569 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068909 predicted 607
2 SASI_Rn01_00068910 predicted 1116
3 SASI_Rn01_00068911 predicted 1377
4 SASI_Rn01_00068912 predicted 703
5 SASI_Rn01_00068913 predicted 1360
6 SASI_Rn01_00068914 predicted 1368
7 SASI_Rn01_00068916 predicted 951
8 SASI_Rn02_00202640 predicted 1059
9 SASI_Rn01_00068917 predicted 594
10 SASI_Rn01_00068918 predicted 1261
11 SASI_Rn01_00068915 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332680 predicted 1286
2 SASI_Mm02_00332681 predicted 982
3 SASI_Mm02_00332682 predicted 1048
4 SASI_Mm02_00332683 predicted 588
5 SASI_Mm02_00332684 predicted 1147
6 SASI_Mm02_00332685 predicted 704
7 SASI_Mm02_00332686 predicted 633
8 SASI_Mm02_00332687 predicted 1016
9 SASI_Mm02_00332688 predicted 1283
10 SASI_Mm02_00332689 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282994 predicted 1566
2 SASI_Mm01_00282995 predicted 1750
3 SASI_Mm01_00282996 predicted 1625
4 SASI_Mm01_00282997 predicted 1574
5 SASI_Mm01_00282998 predicted 1554
6 SASI_Mm01_00282999 predicted 1725
7 SASI_Mm01_00283000 predicted 1538
8 SASI_Mm01_00283001 predicted 1745
9 SASI_Mm01_00283002 predicted 1793
10 SASI_Mm01_00283003 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228800 predicted 2218
2 SASI_Mm01_00228801 predicted 2404
3 SASI_Mm01_00228802 predicted 2270
4 SASI_Mm01_00228803 predicted 2230
5 SASI_Mm01_00228804 predicted 2204
6 SASI_Mm01_00228805 predicted 2373
7 SASI_Mm01_00228806 predicted 2191
8 SASI_Mm01_00228807 predicted 2402
9 SASI_Mm01_00228808 predicted 2454
10 SASI_Mm01_00228809 predicted 2208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213338 predicted 1000
2 SASI_Mm01_00213339 predicted 686
3 SASI_Mm01_00213340 predicted 819
4 SASI_Mm01_00213341 predicted 760
5 SASI_Mm01_00213342 predicted 1192
6 SASI_Mm01_00213343 predicted 1052
7 SASI_Mm01_00213344 predicted 700
8 SASI_Mm01_00213345 predicted 833
9 SASI_Mm01_00213346 predicted 1001
10 SASI_Mm01_00213347 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258948 predicted 639
2 SASI_Mm01_00258949 predicted 831
3 SASI_Mm01_00258950 predicted 693
4 SASI_Mm01_00258951 predicted 642
5 SASI_Mm01_00258952 predicted 1131
6 SASI_Mm01_00258953 predicted 1192
7 SASI_Mm01_00258954 predicted 625
8 SASI_Mm01_00258955 predicted 801
9 SASI_Mm01_00258956 predicted 1075
10 SASI_Mm01_00258957 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248076 predicted 923
2 SASI_Mm01_00248077 predicted 612
3 SASI_Mm01_00248078 predicted 743
4 SASI_Mm01_00248079 predicted 689
5 SASI_Mm01_00248080 predicted 1118
6 SASI_Mm01_00248081 predicted 979
7 SASI_Mm01_00248082 predicted 760
8 SASI_Mm01_00248083 predicted 928
9 SASI_Mm01_00248084 predicted 509
10 SASI_Mm01_00248085 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249716 predicted 782
2 SASI_Mm01_00249717 predicted 474
3 SASI_Mm01_00249718 predicted 602
4 SASI_Mm01_00249719 predicted 545
5 SASI_Mm01_00249720 predicted 976
6 SASI_Mm01_00249721 predicted 837
7 SASI_Mm01_00249722 predicted 484
8 SASI_Mm01_00249723 predicted 611
9 SASI_Mm01_00249724 predicted 794
10 SASI_Mm01_00249725 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270727 predicted 1473
2 SASI_Mm01_00270728 predicted 1662
3 SASI_Mm01_00270729 predicted 1523
4 SASI_Mm01_00270730 predicted 1479
5 SASI_Mm01_00270731 predicted 1455
6 SASI_Mm01_00270732 predicted 1631
7 SASI_Mm01_00270733 predicted 1444
8 SASI_Mm01_00270734 predicted 1646
9 SASI_Mm01_00270735 predicted 1703
10 SASI_Mm01_00270736 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226449 predicted 1293
2 SASI_Mm01_00226450 predicted 985
3 SASI_Mm01_00226451 predicted 1107
4 SASI_Mm01_00226452 predicted 1060
5 SASI_Mm01_00226453 predicted 1488
6 SASI_Mm01_00226454 predicted 1349
7 SASI_Mm01_00226455 predicted 1123
8 SASI_Mm01_00226456 predicted 1301
9 SASI_Mm01_00226457 predicted 880
10 SASI_Mm01_00226458 predicted 1288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027742
VALIDATED
LRRFIP2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat (in FLII) interacting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-1346s21c1
Sequence:CCGGCATAGCTACCTTGGAACAAAGCTCGAGCTTTGTTCCAAGGTAGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027742.2-1150s21c1
Sequence:CCGGACGAGCTCTTGTCACAGATTACTCGAGTAATCTGTGACAAGAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027742.2-2336s21c1
Sequence:CCGGCGCCTGAATCTACCTACTAAACTCGAGTTTAGTAGGTAGATTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-598s21c1
Sequence:CCGGCAAGACCTTCATCTCGAAATTCTCGAGAATTTCGAGATGAAGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-708s21c1
Sequence:CCGGAGTGAACTGCGGGAGTCTTTGCTCGAGCAAAGACTCCCGCAGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027742
VALIDATED
LRRFIP2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat (in FLII) interacting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-1346s21c1
Sequence:CCGGCATAGCTACCTTGGAACAAAGCTCGAGCTTTGTTCCAAGGTAGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027742.2-1150s21c1
Sequence:CCGGACGAGCTCTTGTCACAGATTACTCGAGTAATCTGTGACAAGAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027742.2-2336s21c1
Sequence:CCGGCGCCTGAATCTACCTACTAAACTCGAGTTTAGTAGGTAGATTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-598s21c1
Sequence:CCGGCAAGACCTTCATCTCGAAATTCTCGAGAATTTCGAGATGAAGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-708s21c1
Sequence:CCGGAGTGAACTGCGGGAGTCTTTGCTCGAGCAAAGACTCCCGCAGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027742
VALIDATED
LRRFIP2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat (in FLII) interacting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-1346s21c1
Sequence:CCGGCATAGCTACCTTGGAACAAAGCTCGAGCTTTGTTCCAAGGTAGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027742.2-1150s21c1
Sequence:CCGGACGAGCTCTTGTCACAGATTACTCGAGTAATCTGTGACAAGAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027742.2-2336s21c1
Sequence:CCGGCGCCTGAATCTACCTACTAAACTCGAGTTTAGTAGGTAGATTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-598s21c1
Sequence:CCGGCAAGACCTTCATCTCGAAATTCTCGAGAATTTCGAGATGAAGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027742.2-708s21c1
Sequence:CCGGAGTGAACTGCGGGAGTCTTTGCTCGAGCAAAGACTCCCGCAGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017724
VALIDATED
LRRFIP2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat (in FLII) interacting protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-688s1c1
Sequence:CCGGCGGCAAAGAGATGAGCTTATTCTCGAGAATAAGCTCATCTCTTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1554s1c1
Sequence:CCGGCCGTAATTGTAGAATCATGTTCTCGAGAACATGATTCTACAATTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1022s1c1
Sequence:CCGGCCAATAGACAAATTAGCGAATCTCGAGATTCGCTAATTTGTCTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-410s1c1
Sequence:CCGGGCTTAATAGATCCAGACACTTCTCGAGAAGTGTCTGGATCTATTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1183s1c1
Sequence:CCGGCGGAAGCTACAACGAGAGTTACTCGAGTAACTCTCGTTGTAGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017724
VALIDATED
LRRFIP2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat (in FLII) interacting protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-688s1c1
Sequence:CCGGCGGCAAAGAGATGAGCTTATTCTCGAGAATAAGCTCATCTCTTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1554s1c1
Sequence:CCGGCCGTAATTGTAGAATCATGTTCTCGAGAACATGATTCTACAATTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1022s1c1
Sequence:CCGGCCAATAGACAAATTAGCGAATCTCGAGATTCGCTAATTTGTCTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-410s1c1
Sequence:CCGGGCTTAATAGATCCAGACACTTCTCGAGAAGTGTCTGGATCTATTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1183s1c1
Sequence:CCGGCGGAAGCTACAACGAGAGTTACTCGAGTAACTCTCGTTGTAGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017724
VALIDATED
LRRFIP2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat (in FLII) interacting protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-688s1c1
Sequence:CCGGCGGCAAAGAGATGAGCTTATTCTCGAGAATAAGCTCATCTCTTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1554s1c1
Sequence:CCGGCCGTAATTGTAGAATCATGTTCTCGAGAACATGATTCTACAATTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1022s1c1
Sequence:CCGGCCAATAGACAAATTAGCGAATCTCGAGATTCGCTAATTTGTCTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-410s1c1
Sequence:CCGGGCTTAATAGATCCAGACACTTCTCGAGAAGTGTCTGGATCTATTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_017724.1-1183s1c1
Sequence:CCGGCGGAAGCTACAACGAGAGTTACTCGAGTAACTCTCGTTGTAGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)