EMAIL THIS PAGE TO A FRIEND

LRRIQ1

leucine-rich repeats and IQ motif containing 1

88 Gene Product Result for
UniProtKB ID: Q96JM4, Q567P4, Q9BS17, Q9HA36
Gene ID:
Mouse(74978) leucine-rich repeats and IQ motif containing 1
Rat(299759) leucine-rich repeats and IQ motif containing 1
domestic guinea pig(100732229) leucine-rich repeats and IQ motif containing 1
Domestic Rabbit(100339224) leucine-rich repeats and IQ motif containing 1
naked mole-rat(101723938) leucine-rich repeats and IQ motif containing 1
sheep(101107684) leucine-rich repeats and IQ motif containing 1
Zebrafish(565257) leucine-rich repeats and IQ motif containing 1
cow(781474) leucine-rich repeats and IQ motif containing 1
Horse(100061912) leucine-rich repeats and IQ motif containing 1
domestic cat(101099225) leucine-rich repeats and IQ motif containing 1
dog(100683753) leucine-rich repeats and IQ motif containing 1
chicken(417882) leucine-rich repeats and IQ motif containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079910 Rosetta Predictions human pricing
NM_032165 Rosetta Predictions human pricing
XM_001080693 Rosetta Predictions rat pricing
XM_235088 Rosetta Predictions rat pricing
XM_001478028 Rosetta Predictions mouse pricing
XM_001478416 Rosetta Predictions mouse pricing
XM_991848 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314120 predicted 3091
2 SASI_Hs02_00314121 predicted 3846
3 SASI_Hs02_00314122 predicted 3067
4 SASI_Hs02_00314123 predicted 2658
5 SASI_Hs02_00314124 predicted 2987
6 SASI_Hs02_00314125 predicted 2638
7 SASI_Hs02_00314126 predicted 3510
8 SASI_Hs02_00314127 predicted 3419
9 SASI_Hs02_00314128 predicted 3715
10 SASI_Hs02_00314129 predicted 3082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208394 predicted 3088
2 SASI_Hs01_00208395 predicted 3853
3 SASI_Hs01_00208396 predicted 3068
4 SASI_Hs01_00208397 predicted 2652
5 SASI_Hs01_00208398 predicted 2986
6 SASI_Hs02_00359406 predicted 2632
7 SASI_Hs02_00359407 predicted 3517
8 SASI_Hs01_00208400 predicted 3418
9 SASI_Hs02_00359408 predicted 3715
10 SASI_Hs01_00208403 predicted 3081
11 SASI_Hs01_00208399 predicted 3111
12 SASI_Hs01_00208401 predicted 2131
13 SASI_Hs01_00208402 predicted 3946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368980 predicted 444
2 SASI_Rn02_00368981 predicted 1483
3 SASI_Rn02_00368982 predicted 3532
4 SASI_Rn02_00368983 predicted 2886
5 SASI_Rn02_00368984 predicted 735
6 SASI_Rn02_00368985 predicted 2359
7 SASI_Rn02_00368986 predicted 2527
8 SASI_Rn02_00368987 predicted 1598
9 SASI_Rn02_00368988 predicted 3649
10 SASI_Rn02_00368989 predicted 3641
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388961 predicted 446
2 SASI_Rn02_00388962 predicted 1486
3 SASI_Rn02_00388963 predicted 740
4 SASI_Rn02_00388964 predicted 2368
5 SASI_Rn02_00388965 predicted 2361
6 SASI_Rn02_00388966 predicted 2523
7 SASI_Rn02_00388967 predicted 1600
8 SASI_Rn02_00388968 predicted 2189
9 SASI_Rn02_00388969 predicted 225
10 SASI_Rn02_00388970 predicted 2027
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00399846 predicted 328
2 SASI_Mm02_00399847 predicted 314
3 SASI_Mm02_00399848 predicted 2125
4 SASI_Mm02_00399849 predicted 4166
5 SASI_Mm02_00399850 predicted 2086
6 SASI_Mm02_00399851 predicted 3766
7 SASI_Mm02_00399852 predicted 3187
8 SASI_Mm02_00399853 predicted 662
9 SASI_Mm02_00399854 predicted 281
10 SASI_Mm02_00399855 predicted 3197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00402475 predicted 3531
2 SASI_Mm02_00402476 predicted 2818
3 SASI_Mm02_00402477 predicted 2414
4 SASI_Mm02_00402478 predicted 317
5 SASI_Mm02_00402479 predicted 3104
6 SASI_Mm02_00402480 predicted 2778
7 SASI_Mm02_00402481 predicted 3488
8 SASI_Mm02_00402482 predicted 2085
9 SASI_Mm02_00402483 predicted 666
10 SASI_Mm02_00402484 predicted 3473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239051 predicted 336
2 SASI_Mm01_00239052 predicted 399
3 SASI_Mm01_00239053 predicted 485
4 SASI_Mm01_00239054 predicted 435
5 SASI_Mm01_00239055 predicted 324
6 SASI_Mm01_00239056 predicted 208
7 SASI_Mm01_00239057 predicted 241
8 SASI_Mm01_00239058 predicted 494
9 SASI_Mm01_00239059 predicted 663
10 SASI_Mm01_00239060 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032165
LRRIQ1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and IQ motif containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-3604s1c1
Sequence:CCGGGCACTTTGTCAGTCTCAGATTCTCGAGAATCTGAGACTGACAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-2610s1c1
Sequence:CCGGGCACAGCCTGAGTAATTGTAACTCGAGTTACAATTACTCAGGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032165.2-4193s1c1
Sequence:CCGGCCTAGTAATTTGCTGAAGGATCTCGAGATCCTTCAGCAAATTACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-2214s1c1
Sequence:CCGGCAACTCTCTTAAATCTGAGATCTCGAGATCTCAGATTTAAGAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-1949s1c1
Sequence:CCGGCACTCTCACTAACATCAGAAACTCGAGTTTCTGATGTTAGTGAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032165
LRRIQ1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and IQ motif containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-3604s1c1
Sequence:CCGGGCACTTTGTCAGTCTCAGATTCTCGAGAATCTGAGACTGACAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-2610s1c1
Sequence:CCGGGCACAGCCTGAGTAATTGTAACTCGAGTTACAATTACTCAGGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032165.2-4193s1c1
Sequence:CCGGCCTAGTAATTTGCTGAAGGATCTCGAGATCCTTCAGCAAATTACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-2214s1c1
Sequence:CCGGCAACTCTCTTAAATCTGAGATCTCGAGATCTCAGATTTAAGAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-1949s1c1
Sequence:CCGGCACTCTCACTAACATCAGAAACTCGAGTTTCTGATGTTAGTGAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032165
LRRIQ1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and IQ motif containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-3604s1c1
Sequence:CCGGGCACTTTGTCAGTCTCAGATTCTCGAGAATCTGAGACTGACAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-2610s1c1
Sequence:CCGGGCACAGCCTGAGTAATTGTAACTCGAGTTACAATTACTCAGGCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032165.2-4193s1c1
Sequence:CCGGCCTAGTAATTTGCTGAAGGATCTCGAGATCCTTCAGCAAATTACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-2214s1c1
Sequence:CCGGCAACTCTCTTAAATCTGAGATCTCGAGATCTCAGATTTAAGAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032165.2-1949s1c1
Sequence:CCGGCACTCTCACTAACATCAGAAACTCGAGTTTCTGATGTTAGTGAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029134
LRRIQ1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and IQ motif containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-307s21c1
Sequence:CCGGGATTATAAGAAAGGTTGTAACCTCGAGGTTACAACCTTTCTTATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-387s21c1
Sequence:CCGGAGCAAATGCTGAGCAATTAATCTCGAGATTAATTGCTCAGCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-280s21c1
Sequence:CCGGGACGTAGAAGATACTGATATCCTCGAGGATATCAGTATCTTCTACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-1244s21c1
Sequence:CCGGCCCACTCGCCACTGATCATTACTCGAGTAATGATCAGTGGCGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-2145s21c1
Sequence:CCGGTGGTAGTCACAGTGCTAATAACTCGAGTTATTAGCACTGTGACTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029134
LRRIQ1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and IQ motif containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-307s21c1
Sequence:CCGGGATTATAAGAAAGGTTGTAACCTCGAGGTTACAACCTTTCTTATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-387s21c1
Sequence:CCGGAGCAAATGCTGAGCAATTAATCTCGAGATTAATTGCTCAGCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-280s21c1
Sequence:CCGGGACGTAGAAGATACTGATATCCTCGAGGATATCAGTATCTTCTACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-1244s21c1
Sequence:CCGGCCCACTCGCCACTGATCATTACTCGAGTAATGATCAGTGGCGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-2145s21c1
Sequence:CCGGTGGTAGTCACAGTGCTAATAACTCGAGTTATTAGCACTGTGACTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029134
LRRIQ1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and IQ motif containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-307s21c1
Sequence:CCGGGATTATAAGAAAGGTTGTAACCTCGAGGTTACAACCTTTCTTATAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-387s21c1
Sequence:CCGGAGCAAATGCTGAGCAATTAATCTCGAGATTAATTGCTCAGCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-280s21c1
Sequence:CCGGGACGTAGAAGATACTGATATCCTCGAGGATATCAGTATCTTCTACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-1244s21c1
Sequence:CCGGCCCACTCGCCACTGATCATTACTCGAGTAATGATCAGTGGCGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029134.2-2145s21c1
Sequence:CCGGTGGTAGTCACAGTGCTAATAACTCGAGTTATTAGCACTGTGACTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)