EMAIL THIS PAGE TO A FRIEND

LRRIQ3

leucine-rich repeats and IQ motif containing 3

88 Gene Product Result for
Synonyms: LRRC44
UniProtKB ID: A6PVS8, A6PVS9, Q6P5P7, Q6ZMV4, Q8WUE0
Gene ID:
Mouse(74435) leucine-rich repeats and IQ motif containing 3
Rat(499732) leucine-rich repeats and IQ motif containing 3
dog(479990) leucine-rich repeats and IQ motif containing 3
domestic cat(101085305) leucine-rich repeats and IQ motif containing 3
Horse(100067897) leucine-rich repeats and IQ motif containing 3
cow(523789) leucine-rich repeats and IQ motif containing 3
sheep(101119772) leucine-rich repeats and IQ motif containing 3
naked mole-rat(101714339) leucine-rich repeats and IQ motif containing 3
Domestic Rabbit(100346894) leucine-rich repeats and IQ motif containing 3
domestic guinea pig(100718907) leucine-rich repeats and IQ motif containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145258 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065291 MISSION® esiRNA esiRNA targeting mouse Lrriq3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105659 Rosetta Predictions human pricing
NM_145258 Rosetta Predictions human pricing
NM_001024307 Rosetta Predictions rat pricing
NM_028938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324621 predicted 1387
2 SASI_Hs02_00324622 predicted 1804
3 SASI_Hs02_00324623 predicted 2076
4 SASI_Hs02_00324624 predicted 204
5 SASI_Hs02_00324625 predicted 1423
6 SASI_Hs02_00324626 predicted 1253
7 SASI_Hs02_00324627 predicted 1379
8 SASI_Hs02_00324628 predicted 222
9 SASI_Hs02_00324629 predicted 567
10 SASI_Hs02_00324630 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042972 predicted 249
2 SASI_Hs01_00042973 predicted 312
3 SASI_Hs01_00042974 predicted 295
4 SASI_Hs01_00042975 predicted 309
5 SASI_Hs01_00042976 predicted 290
6 SASI_Hs01_00042977 predicted 469
7 SASI_Hs01_00042978 predicted 376
8 SASI_Hs01_00042979 predicted 308
9 SASI_Hs01_00042980 predicted 352
10 SASI_Hs01_00042981 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114329 predicted 884
2 SASI_Rn01_00114330 predicted 1118
3 SASI_Rn01_00114331 predicted 483
4 SASI_Rn01_00114332 predicted 2056
5 SASI_Rn01_00114333 predicted 782
6 SASI_Rn01_00114334 predicted 947
7 SASI_Rn01_00114335 predicted 709
8 SASI_Rn01_00114336 predicted 2031
9 SASI_Rn01_00114337 predicted 646
10 SASI_Rn01_00114338 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334640 predicted 2123
2 SASI_Mm01_00029331 predicted 409
3 SASI_Mm01_00029332 predicted 812
4 SASI_Mm01_00029333 predicted 1352
5 SASI_Mm01_00029334 predicted 877
6 SASI_Mm01_00029335 predicted 1283
7 SASI_Mm01_00029336 predicted 979
8 SASI_Mm01_00029338 predicted 581
9 SASI_Mm02_00334641 predicted 2139
10 SASI_Mm02_00334642 predicted 2100
11 SASI_Mm01_00029330 predicted 376
12 SASI_Mm01_00029337 predicted 474
13 SASI_Mm01_00029339 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028938
LRRIQ3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and IQ motif containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-1061s21c1
Sequence:CCGGTCAAGCCTGAATGCAACATAACTCGAGTTATGTTGCATTCAGGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-277s21c1
Sequence:CCGGGAGGAATGGAGTCACTATAATCTCGAGATTATAGTGACTCCATTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-741s21c1
Sequence:CCGGGCGTCTTCCAGAGAGGTTTAACTCGAGTTAAACCTCTCTGGAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028938.1-1828s1c1
Sequence:CCGGGCAGGATTTGTTGATGGAAATCTCGAGATTTCCATCAACAAATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-811s1c1
Sequence:CCGGCGTGGTTTCATAGTTAGGAAACTCGAGTTTCCTAACTATGAAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-1273s1c1
Sequence:CCGGCCACAATACCTCCAGCCATTTCTCGAGAAATGGCTGGAGGTATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-668s1c1
Sequence:CCGGCCAGTCTATTCTTTAACCTTTCTCGAGAAAGGTTAAAGAATAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-667s1c1
Sequence:CCGGCCCAGTCTATTCTTTAACCTTCTCGAGAAGGTTAAAGAATAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028938
LRRIQ3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and IQ motif containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-1061s21c1
Sequence:CCGGTCAAGCCTGAATGCAACATAACTCGAGTTATGTTGCATTCAGGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-277s21c1
Sequence:CCGGGAGGAATGGAGTCACTATAATCTCGAGATTATAGTGACTCCATTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-741s21c1
Sequence:CCGGGCGTCTTCCAGAGAGGTTTAACTCGAGTTAAACCTCTCTGGAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028938.1-1828s1c1
Sequence:CCGGGCAGGATTTGTTGATGGAAATCTCGAGATTTCCATCAACAAATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-811s1c1
Sequence:CCGGCGTGGTTTCATAGTTAGGAAACTCGAGTTTCCTAACTATGAAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-1273s1c1
Sequence:CCGGCCACAATACCTCCAGCCATTTCTCGAGAAATGGCTGGAGGTATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-668s1c1
Sequence:CCGGCCAGTCTATTCTTTAACCTTTCTCGAGAAAGGTTAAAGAATAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-667s1c1
Sequence:CCGGCCCAGTCTATTCTTTAACCTTCTCGAGAAGGTTAAAGAATAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028938
LRRIQ3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and IQ motif containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-1061s21c1
Sequence:CCGGTCAAGCCTGAATGCAACATAACTCGAGTTATGTTGCATTCAGGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-277s21c1
Sequence:CCGGGAGGAATGGAGTCACTATAATCTCGAGATTATAGTGACTCCATTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028938.2-741s21c1
Sequence:CCGGGCGTCTTCCAGAGAGGTTTAACTCGAGTTAAACCTCTCTGGAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028938.1-1828s1c1
Sequence:CCGGGCAGGATTTGTTGATGGAAATCTCGAGATTTCCATCAACAAATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-811s1c1
Sequence:CCGGCGTGGTTTCATAGTTAGGAAACTCGAGTTTCCTAACTATGAAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-1273s1c1
Sequence:CCGGCCACAATACCTCCAGCCATTTCTCGAGAAATGGCTGGAGGTATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-668s1c1
Sequence:CCGGCCAGTCTATTCTTTAACCTTTCTCGAGAAAGGTTAAAGAATAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028938.1-667s1c1
Sequence:CCGGCCCAGTCTATTCTTTAACCTTCTCGAGAAGGTTAAAGAATAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145258
LRRIQ3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and IQ motif containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-295s1c1
Sequence:CCGGCTTGCATCTCTCTTAGAGTATCTCGAGATACTCTAAGAGAGATGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-189s1c1
Sequence:CCGGCATGAAGAATGGAGTCACTATCTCGAGATAGTGACTCCATTCTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-499s1c1
Sequence:CCGGGTGTATTATCTGCCTGTCCAACTCGAGTTGGACAGGCAGATAATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-298s1c1
Sequence:CCGGGCATCTCTCTTAGAGTATGCACTCGAGTGCATACTCTAAGAGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145258.1-1136s1c1
Sequence:CCGGGCCTAGTTCTCTCAGGTAAATCTCGAGATTTACCTGAGAGAACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-610s1c1
Sequence:CCGGCGCTGGATCATCATGTGATTTCTCGAGAAATCACATGATGATCCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145258.1-924s1c1
Sequence:CCGGGCTGGATAACTGGGACAGAAACTCGAGTTTCTGTCCCAGTTATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-251s1c1
Sequence:CCGGGAAGTTCAATGGCCTTCATTTCTCGAGAAATGAAGGCCATTGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-528s1c1
Sequence:CCGGGCCCTCACTATGTTTGATTGTCTCGAGACAATCAAACATAGTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-299s1c1
Sequence:CCGGCATCTCTCTTAGAGTATGCATCTCGAGATGCATACTCTAAGAGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-663s1c1
Sequence:CCGGCCTGAAAGATTCAAAGCATGTCTCGAGACATGCTTTGAATCTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145258
LRRIQ3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and IQ motif containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-295s1c1
Sequence:CCGGCTTGCATCTCTCTTAGAGTATCTCGAGATACTCTAAGAGAGATGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-189s1c1
Sequence:CCGGCATGAAGAATGGAGTCACTATCTCGAGATAGTGACTCCATTCTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-499s1c1
Sequence:CCGGGTGTATTATCTGCCTGTCCAACTCGAGTTGGACAGGCAGATAATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-298s1c1
Sequence:CCGGGCATCTCTCTTAGAGTATGCACTCGAGTGCATACTCTAAGAGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145258.1-1136s1c1
Sequence:CCGGGCCTAGTTCTCTCAGGTAAATCTCGAGATTTACCTGAGAGAACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-610s1c1
Sequence:CCGGCGCTGGATCATCATGTGATTTCTCGAGAAATCACATGATGATCCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145258.1-924s1c1
Sequence:CCGGGCTGGATAACTGGGACAGAAACTCGAGTTTCTGTCCCAGTTATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-251s1c1
Sequence:CCGGGAAGTTCAATGGCCTTCATTTCTCGAGAAATGAAGGCCATTGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-528s1c1
Sequence:CCGGGCCCTCACTATGTTTGATTGTCTCGAGACAATCAAACATAGTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-299s1c1
Sequence:CCGGCATCTCTCTTAGAGTATGCATCTCGAGATGCATACTCTAAGAGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-663s1c1
Sequence:CCGGCCTGAAAGATTCAAAGCATGTCTCGAGACATGCTTTGAATCTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145258
LRRIQ3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and IQ motif containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-295s1c1
Sequence:CCGGCTTGCATCTCTCTTAGAGTATCTCGAGATACTCTAAGAGAGATGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-189s1c1
Sequence:CCGGCATGAAGAATGGAGTCACTATCTCGAGATAGTGACTCCATTCTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-499s1c1
Sequence:CCGGGTGTATTATCTGCCTGTCCAACTCGAGTTGGACAGGCAGATAATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-298s1c1
Sequence:CCGGGCATCTCTCTTAGAGTATGCACTCGAGTGCATACTCTAAGAGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145258.1-1136s1c1
Sequence:CCGGGCCTAGTTCTCTCAGGTAAATCTCGAGATTTACCTGAGAGAACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-610s1c1
Sequence:CCGGCGCTGGATCATCATGTGATTTCTCGAGAAATCACATGATGATCCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145258.1-924s1c1
Sequence:CCGGGCTGGATAACTGGGACAGAAACTCGAGTTTCTGTCCCAGTTATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-251s1c1
Sequence:CCGGGAAGTTCAATGGCCTTCATTTCTCGAGAAATGAAGGCCATTGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-528s1c1
Sequence:CCGGGCCCTCACTATGTTTGATTGTCTCGAGACAATCAAACATAGTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-299s1c1
Sequence:CCGGCATCTCTCTTAGAGTATGCATCTCGAGATGCATACTCTAAGAGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145258.1-663s1c1
Sequence:CCGGCCTGAAAGATTCAAAGCATGTCTCGAGACATGCTTTGAATCTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)