EMAIL THIS PAGE TO A FRIEND

LRRK1

leucine-rich repeat kinase 1

207 Gene Product Result for
Synonyms: RIPK6 Roco1
Gene ID:
Mouse(233328) leucine-rich repeat kinase 1
Rat(308703) leucine-rich repeat kinase 1
Zebrafish(100332050) leucine-rich repeat kinase 1
chicken(415520) leucine-rich repeat kinase 1
domestic cat(101082914) leucine-rich repeat kinase 1
cow(513994) leucine-rich repeat kinase 1
Horse(100050271) leucine-rich repeat kinase 1
dog(488706) leucine-rich repeat kinase 1
sheep(101115404) leucine-rich repeat kinase 1
naked mole-rat(101699472) leucine-rich repeat kinase 1
domestic guinea pig(100713402) leucine-rich repeat kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_485946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_485946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_485946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024652 Rosetta Predictions human pricing
XM_001056955 Rosetta Predictions rat pricing
XM_218760 Rosetta Predictions rat pricing
NM_146191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147892 predicted 4520
2 SASI_Hs01_00147893 predicted 4989
3 SASI_Hs01_00147894 predicted 3087
4 SASI_Hs01_00147895 predicted 4545
5 SASI_Hs01_00147896 predicted 1550
6 SASI_Hs01_00147897 predicted 4532
7 SASI_Hs01_00147899 predicted 3969
8 SASI_Hs01_00147900 predicted 6371
9 SASI_Hs01_00147901 predicted 3351
10 SASI_Hs02_00357050 predicted 3071
11 SASI_Hs01_00147898 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284930 predicted 5509
2 SASI_Rn02_00284931 predicted 2130
3 SASI_Rn02_00284932 predicted 1005
4 SASI_Rn02_00284933 predicted 2683
5 SASI_Rn02_00284934 predicted 2379
6 SASI_Rn02_00284935 predicted 790
7 SASI_Rn02_00284936 predicted 2653
8 SASI_Rn02_00284937 predicted 5059
9 SASI_Rn02_00284938 predicted 2039
10 SASI_Rn02_00284939 predicted 2358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378052 predicted 5506
2 SASI_Rn02_00378053 predicted 2137
3 SASI_Rn02_00378054 predicted 1008
4 SASI_Rn02_00378055 predicted 2686
5 SASI_Rn02_00378056 predicted 2379
6 SASI_Rn02_00378057 predicted 790
7 SASI_Rn02_00378058 predicted 2657
8 SASI_Rn02_00378059 predicted 5062
9 SASI_Rn02_00378060 predicted 2032
10 SASI_Rn02_00378061 predicted 2355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132389 predicted 886
2 SASI_Mm01_00132390 predicted 5506
3 SASI_Mm01_00132391 predicted 1748
4 SASI_Mm02_00341888 predicted 1476
5 SASI_Mm01_00132392 predicted 2040
6 SASI_Mm01_00132393 predicted 2393
7 SASI_Mm01_00132395 predicted 2686
8 SASI_Mm01_00132396 predicted 2076
9 SASI_Mm01_00132397 predicted 5986
10 SASI_Mm01_00132398 predicted 4570
11 SASI_Mm01_00132394 predicted 5830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024652
VALIDATED
LRRK1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat kinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-3075s21c1
Sequence:GTACCGGTCTACTTCCTCGACCCTATTTCTCGAGAAATAGGGTCGAGGAAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-4366s21c1
Sequence:CCGGCGCCAGAGATTCTTCCTTTATCTCGAGATAAAGGAAGAATCTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-3354s21c1
Sequence:CCGGACACCATTCAGAGGGTATTTACTCGAGTAAATACCCTCTGAATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024652.3-6734s21c1
Sequence:CCGGCCCAGGTCTCAGATGGAATTACTCGAGTAATTCCATCTGAGACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-1308s21c1
Sequence:CCGGGGCTACTTGAAATTGACATTTCTCGAGAAATGTCAATTTCAAGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-6091s21c1
Sequence:CCGGCGGTGGAGATGTTATCGTCATCTCGAGATGACGATAACATCTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-394s21c1
Sequence:GTACCGGACGTGCCATGGAGACGCTTAACTCGAGTTAAGCGTCTCCATGGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024652.2-3889s1c1
Sequence:CCGGGCCGAGTCATTGCCGTCTTAACTCGAGTTAAGACGGCAATGACTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-4479s1c1
Sequence:CCGGCCCAGGTCTCAGATGGAATTACTCGAGTAATTCCATCTGAGACCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-3836s1c1
Sequence:CCGGCGGTGGAGATGTTATCGTCATCTCGAGATGACGATAACATCTCCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024652.2-338s1c1
Sequence:CCGGCCTGGATTTAATTGAAGCCAACTCGAGTTGGCTTCAATTAAATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-1096s1c1
Sequence:CCGGCCAACACCATTCAGAGGGTATCTCGAGATACCCTCTGAATGGTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-2111s1c1
Sequence:CCGGCGCCAGAGATTCTTCCTTTATCTCGAGATAAAGGAAGAATCTCTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024652
VALIDATED
LRRK1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat kinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-3075s21c1
Sequence:GTACCGGTCTACTTCCTCGACCCTATTTCTCGAGAAATAGGGTCGAGGAAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-4366s21c1
Sequence:CCGGCGCCAGAGATTCTTCCTTTATCTCGAGATAAAGGAAGAATCTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-3354s21c1
Sequence:CCGGACACCATTCAGAGGGTATTTACTCGAGTAAATACCCTCTGAATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024652.3-6734s21c1
Sequence:CCGGCCCAGGTCTCAGATGGAATTACTCGAGTAATTCCATCTGAGACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-1308s21c1
Sequence:CCGGGGCTACTTGAAATTGACATTTCTCGAGAAATGTCAATTTCAAGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-6091s21c1
Sequence:CCGGCGGTGGAGATGTTATCGTCATCTCGAGATGACGATAACATCTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-394s21c1
Sequence:GTACCGGACGTGCCATGGAGACGCTTAACTCGAGTTAAGCGTCTCCATGGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024652.2-3889s1c1
Sequence:CCGGGCCGAGTCATTGCCGTCTTAACTCGAGTTAAGACGGCAATGACTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-4479s1c1
Sequence:CCGGCCCAGGTCTCAGATGGAATTACTCGAGTAATTCCATCTGAGACCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-3836s1c1
Sequence:CCGGCGGTGGAGATGTTATCGTCATCTCGAGATGACGATAACATCTCCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024652.2-338s1c1
Sequence:CCGGCCTGGATTTAATTGAAGCCAACTCGAGTTGGCTTCAATTAAATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-1096s1c1
Sequence:CCGGCCAACACCATTCAGAGGGTATCTCGAGATACCCTCTGAATGGTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-2111s1c1
Sequence:CCGGCGCCAGAGATTCTTCCTTTATCTCGAGATAAAGGAAGAATCTCTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024652
VALIDATED
LRRK1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat kinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-3075s21c1
Sequence:GTACCGGTCTACTTCCTCGACCCTATTTCTCGAGAAATAGGGTCGAGGAAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-4366s21c1
Sequence:CCGGCGCCAGAGATTCTTCCTTTATCTCGAGATAAAGGAAGAATCTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-3354s21c1
Sequence:CCGGACACCATTCAGAGGGTATTTACTCGAGTAAATACCCTCTGAATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024652.3-6734s21c1
Sequence:CCGGCCCAGGTCTCAGATGGAATTACTCGAGTAATTCCATCTGAGACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-1308s21c1
Sequence:CCGGGGCTACTTGAAATTGACATTTCTCGAGAAATGTCAATTTCAAGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-6091s21c1
Sequence:CCGGCGGTGGAGATGTTATCGTCATCTCGAGATGACGATAACATCTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024652.3-394s21c1
Sequence:GTACCGGACGTGCCATGGAGACGCTTAACTCGAGTTAAGCGTCTCCATGGCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024652.2-3889s1c1
Sequence:CCGGGCCGAGTCATTGCCGTCTTAACTCGAGTTAAGACGGCAATGACTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-4479s1c1
Sequence:CCGGCCCAGGTCTCAGATGGAATTACTCGAGTAATTCCATCTGAGACCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-3836s1c1
Sequence:CCGGCGGTGGAGATGTTATCGTCATCTCGAGATGACGATAACATCTCCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024652.2-338s1c1
Sequence:CCGGCCTGGATTTAATTGAAGCCAACTCGAGTTGGCTTCAATTAAATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-1096s1c1
Sequence:CCGGCCAACACCATTCAGAGGGTATCTCGAGATACCCTCTGAATGGTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024652.2-2111s1c1
Sequence:CCGGCGCCAGAGATTCTTCCTTTATCTCGAGATAAAGGAAGAATCTCTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146191
LRRK1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-3463s21c1
Sequence:CCGGACATTCCGAGTCCGAAGAAATCTCGAGATTTCTTCGGACTCGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-2880s21c1
Sequence:CCGGGCAGACGCCTGGCAATGATATCTCGAGATATCATTGCCAGGCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146191.3-6557s21c1
Sequence:CCGGTCCAAGCCTTCCCGGCATAATCTCGAGATTATGCCGGGAAGGCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-3408s21c1
Sequence:CCGGGAACCGGAAAGTCACTATTTACTCGAGTAAATAGTGACTTTCCGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-1419s21c1
Sequence:CCGGAGAGCTCCCTGTCCAATTTATCTCGAGATAAATTGGACAGGGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146191.3-6417s21c1
Sequence:CCGGCTAGGAGCTACTGGTAGTTTGCTCGAGCAAACTACCAGTAGCTCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-317s21c1
Sequence:CCGGCTGCCATGGAGACCCATAATGCTCGAGCATTATGGGTCTCCATGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-5064s21c1
Sequence:CCGGTAAGGGTATGTGCCCATTAAGCTCGAGCTTAATGGGCACATACCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146191
LRRK1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-3463s21c1
Sequence:CCGGACATTCCGAGTCCGAAGAAATCTCGAGATTTCTTCGGACTCGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-2880s21c1
Sequence:CCGGGCAGACGCCTGGCAATGATATCTCGAGATATCATTGCCAGGCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146191.3-6557s21c1
Sequence:CCGGTCCAAGCCTTCCCGGCATAATCTCGAGATTATGCCGGGAAGGCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-3408s21c1
Sequence:CCGGGAACCGGAAAGTCACTATTTACTCGAGTAAATAGTGACTTTCCGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-1419s21c1
Sequence:CCGGAGAGCTCCCTGTCCAATTTATCTCGAGATAAATTGGACAGGGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146191.3-6417s21c1
Sequence:CCGGCTAGGAGCTACTGGTAGTTTGCTCGAGCAAACTACCAGTAGCTCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-317s21c1
Sequence:CCGGCTGCCATGGAGACCCATAATGCTCGAGCATTATGGGTCTCCATGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-5064s21c1
Sequence:CCGGTAAGGGTATGTGCCCATTAAGCTCGAGCTTAATGGGCACATACCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146191
LRRK1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-3463s21c1
Sequence:CCGGACATTCCGAGTCCGAAGAAATCTCGAGATTTCTTCGGACTCGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-2880s21c1
Sequence:CCGGGCAGACGCCTGGCAATGATATCTCGAGATATCATTGCCAGGCGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146191.3-6557s21c1
Sequence:CCGGTCCAAGCCTTCCCGGCATAATCTCGAGATTATGCCGGGAAGGCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-3408s21c1
Sequence:CCGGGAACCGGAAAGTCACTATTTACTCGAGTAAATAGTGACTTTCCGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-1419s21c1
Sequence:CCGGAGAGCTCCCTGTCCAATTTATCTCGAGATAAATTGGACAGGGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146191.3-6417s21c1
Sequence:CCGGCTAGGAGCTACTGGTAGTTTGCTCGAGCAAACTACCAGTAGCTCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-317s21c1
Sequence:CCGGCTGCCATGGAGACCCATAATGCTCGAGCATTATGGGTCTCCATGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146191.3-5064s21c1
Sequence:CCGGTAAGGGTATGTGCCCATTAAGCTCGAGCTTAATGGGCACATACCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_485946
VALIDATED
LRRK1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_485946.1-6965s1c1
Sequence:CCGGCCTGTGTTTATGACTTGGTAACTCGAGTTACCAAGTCATAAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-4424s1c1
Sequence:CCGGCAAGGAGCATATCAACATCAACTCGAGTTGATGTTGATATGCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-878s1c1
Sequence:CCGGAGCCTATTTCTGCTCCTACATCTCGAGATGTAGGAGCAGAAATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-4116s1c1
Sequence:CCGGGCCATGAAGAACTTCTCAGATCTCGAGATCTGAGAAGTTCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_485946.1-1647s1c1
Sequence:CCGGGCCCTCATGTTCTTGAGGTTACTCGAGTAACCTCAAGAACATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_485946
VALIDATED
LRRK1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_485946.1-6965s1c1
Sequence:CCGGCCTGTGTTTATGACTTGGTAACTCGAGTTACCAAGTCATAAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-4424s1c1
Sequence:CCGGCAAGGAGCATATCAACATCAACTCGAGTTGATGTTGATATGCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-878s1c1
Sequence:CCGGAGCCTATTTCTGCTCCTACATCTCGAGATGTAGGAGCAGAAATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-4116s1c1
Sequence:CCGGGCCATGAAGAACTTCTCAGATCTCGAGATCTGAGAAGTTCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_485946.1-1647s1c1
Sequence:CCGGGCCCTCATGTTCTTGAGGTTACTCGAGTAACCTCAAGAACATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_485946
VALIDATED
LRRK1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_485946.1-6965s1c1
Sequence:CCGGCCTGTGTTTATGACTTGGTAACTCGAGTTACCAAGTCATAAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-4424s1c1
Sequence:CCGGCAAGGAGCATATCAACATCAACTCGAGTTGATGTTGATATGCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-878s1c1
Sequence:CCGGAGCCTATTTCTGCTCCTACATCTCGAGATGTAGGAGCAGAAATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485946.1-4116s1c1
Sequence:CCGGGCCATGAAGAACTTCTCAGATCTCGAGATCTGAGAAGTTCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:XM_485946.1-1647s1c1
Sequence:CCGGGCCCTCATGTTCTTGAGGTTACTCGAGTAACCTCAAGAACATGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)