EMAIL THIS PAGE TO A FRIEND

LRRK2

leucine-rich repeat kinase 2

194 Gene Product Result for
Synonyms: AURA17 DARDARIN PARK8 RIPK7 ROCO2
UniProtKB ID: Q5S007, A6NJU2, Q6ZS50, Q8NCX9
Gene ID:
Human(120892) Summary: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
Mouse(66725) leucine-rich repeat kinase 2
Rat(300160) leucine-rich repeat kinase 2
domestic guinea pig(100730338) leucine-rich repeat kinase 2
naked mole-rat(101708809) leucine-rich repeat kinase 2
sheep(101111447) leucine-rich repeat kinase 2
Zebrafish(559366) leucine-rich repeat kinase 2
cow(535652) leucine-rich repeat kinase 2
chicken(427844) leucine-rich repeat kinase 2
domestic cat(101096157) leucine-rich repeat kinase 2
dog(486608) leucine-rich repeat kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
L9918 Anti-LRRK2 (C-terminal region) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
L0169 Anti-LRRK2 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA014293 Anti-LRRK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500604 Anti-LRRK2/PARK8, near C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine
ELISA, immunohistochemistry, western blot pricing
SAB1306028 ANTI-PARK8 (LRRK2) (E519) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306358 ANTI-PARK8 (LRRK2) (L893) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1306359 ANTI-PARK8 (LRRK2) (L899) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306167 ANTI-PARK8 (LRRK2) (L955) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunofluorescence, western blot pricing
L3044 Monoclonal Anti-LRRK2 antibody produced in mouse ~1.0 mg/mL, clone PROK57, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
WH0120892M1 Monoclonal Anti-LRRK2 antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5201185 Monoclonal Anti-Lrrk2/Dardarin - Alkaline Phosphatase antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201203 Monoclonal Anti-Lrrk2/Dardarin - Alkaline Phosphatase antibody produced in mouse clone S138-6, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201186 Monoclonal Anti-Lrrk2/Dardarin - Apc antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201204 Monoclonal Anti-Lrrk2/Dardarin - Apc antibody produced in mouse clone S138-6, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201177 Monoclonal Anti-Lrrk2/Dardarin - Atto 390 antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201195 Monoclonal Anti-Lrrk2/Dardarin - Atto 390 antibody produced in mouse clone S138-6, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201178 Monoclonal Anti-Lrrk2/Dardarin - Atto 488 antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201196 Monoclonal Anti-Lrrk2/Dardarin - Atto 488 antibody produced in mouse clone S138-6, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201179 Monoclonal Anti-Lrrk2/Dardarin - Atto 565 antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201197 Monoclonal Anti-Lrrk2/Dardarin - Atto 565 antibody produced in mouse clone S138-6, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201180 Monoclonal Anti-Lrrk2/Dardarin - Atto 594 antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201198 Monoclonal Anti-Lrrk2/Dardarin - Atto 594 antibody produced in mouse clone S138-6, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201181 Monoclonal Anti-Lrrk2/Dardarin - Atto 633 antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201199 Monoclonal Anti-Lrrk2/Dardarin - Atto 633 antibody produced in mouse clone S138-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201182 Monoclonal Anti-Lrrk2/Dardarin - Atto 655 antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201200 Monoclonal Anti-Lrrk2/Dardarin - Atto 655 antibody produced in mouse clone S138-6, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201183 Monoclonal Anti-Lrrk2/Dardarin - Atto 680 antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201201 Monoclonal Anti-Lrrk2/Dardarin - Atto 680 antibody produced in mouse clone S138-6, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201184 Monoclonal Anti-Lrrk2/Dardarin - Atto 700 antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201202 Monoclonal Anti-Lrrk2/Dardarin - Atto 700 antibody produced in mouse clone S138-6, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201187 Monoclonal Anti-Lrrk2/Dardarin - Biotin antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201205 Monoclonal Anti-Lrrk2/Dardarin - Biotin antibody produced in mouse clone S138-6, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201188 Monoclonal Anti-Lrrk2/Dardarin - Fitc antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201206 Monoclonal Anti-Lrrk2/Dardarin - Fitc antibody produced in mouse clone S138-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201189 Monoclonal Anti-Lrrk2/Dardarin - Hrp antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201207 Monoclonal Anti-Lrrk2/Dardarin - Hrp antibody produced in mouse clone S138-6, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201190 Monoclonal Anti-Lrrk2/Dardarin - Pe/Atto 594 antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201208 Monoclonal Anti-Lrrk2/Dardarin - Pe/Atto 594 antibody produced in mouse clone S138-6, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201191 Monoclonal Anti-Lrrk2/Dardarin - Percp antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201209 Monoclonal Anti-Lrrk2/Dardarin - Percp antibody produced in mouse clone S138-6, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201192 Monoclonal Anti-Lrrk2/Dardarin - Rpe antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201210 Monoclonal Anti-Lrrk2/Dardarin - Rpe antibody produced in mouse clone S138-6, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201193 Monoclonal Anti-Lrrk2/Dardarin - Streptavidin antibody produced in mouse clone S231B-34, purified immunoglobulin human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201211 Monoclonal Anti-Lrrk2/Dardarin - Streptavidin antibody produced in mouse clone S138-6, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201176 Monoclonal Anti-Lrrk2/Dardarin antibody produced in mouse clone S231B-34, purified immunoglobulin rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201194 Monoclonal Anti-Lrrk2/Dardarin antibody produced in mouse clone S138-6, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB1305528 MONOCLONAL ANTI-PARK8 (LRRK2) antibody produced in mouse clone 133AT720, IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1305527 MONOCLONAL ANTI-PARK8 (LRRK2) antibody produced in mouse clone 133AT1218, IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0429 AQUA Peptide IFDHEDLL[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_058513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_058513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_058513 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198578 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
AB9682 Anti-Dardarin Antibody Anti-Dardarin Antibody detects level of Dardarin & has been published & validated for use in ELISA & WB. pricing
AB9704 Anti-LRRK2 Antibody Detect LRRK2 using this ANTI-LRRK2 Antibody validated for use in IH. pricing
ABN187 Anti-LRRK2 Antibody This Anti-LRRK2 Antibody is validated for use in WB, IH(P) for the detection of LRRK2. This antibody is known as JH5514 in scientific publications. pricing
MABN636 Anti-LRRK2 Antibody, clone 8G10 Detect LRRK2 using this mouse monoclonal antibody, Anti-LRRK2 Antibody, clone 8G10 validated for use in western blotting & IHC. pricing
MABN40 Anti-LRRK2 Antibody, clone N138/6 Anti-LRRK2 Antibody, clone N138/6 detects level of LRRK2 & has been published & validated for use in IH & WB. pricing
MABN541 Anti-LRRK2 Antibody, clone N231B/34 Detect LRRK2 using this mouse monoclonal antibody, Anti-LRRK2 Antibody & clone N231B/34 validated for use in western blotting. pricing
MABN538 Anti-MeCP2 Antibody, clone N227/21 Detect MeCP2 using this mouse monoclonal antibody, Anti-MeCP2 Antibody, clone N227/21 validated for use in IHC & Dot Blot. pricing
MABN635 Anti-phospho LRRK2 (Ser910) Antibody, clone ID8 Detect LRRK2 using this mouse monoclonal antibody, Anti-phospho LRRK2 (Ser910) Antibody & clone ID8 validated for use in western blotting. pricing
ABS108 Anti-phospho-LRRK2 (Tyr1491) Antibody Anti-phospho-LRRK2 (Tyr1491) Antibody is an antibody against phospho-LRRK2 (Tyr1491) for use in Western Blotting, Peptide Inhibition Assay. pricing
14-919-M LRRK2 Protein, active, 10 µg Active, N-terminal FLAG-tagged, recombinant, human LRRK2, amino acids 970-end. For use in Kinase Assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198578 Rosetta Predictions human pricing
XM_001057114 Rosetta Predictions rat pricing
XM_235581 Rosetta Predictions rat pricing
NM_025730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242428 predicted 5961
2 SASI_Hs01_00242433 predicted 4739
3 SASI_Hs02_00372210 predicted 2639
4 SASI_Hs01_00242434 predicted 5230
5 SASI_Hs02_00372211 predicted 6318
6 SASI_Hs01_00242435 predicted 6322
7 SASI_Hs02_00372212 predicted 2941
8 SASI_Hs01_00242436 predicted 6074
9 SASI_Hs01_00242437 predicted 2414
10 SASI_Hs02_00372213 predicted 2099
11 SASI_Hs01_00242429 predicted 2025
12 SASI_Hs01_00242430 predicted 937
13 SASI_Hs01_00242431 predicted 5243
14 SASI_Hs01_00242432 predicted 3574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285459 predicted 3745
2 SASI_Rn02_00285460 predicted 4603
3 SASI_Rn02_00285461 predicted 6613
4 SASI_Rn02_00285462 predicted 1954
5 SASI_Rn02_00285463 predicted 6001
6 SASI_Rn02_00285464 predicted 2872
7 SASI_Rn02_00285465 predicted 2313
8 SASI_Rn02_00285466 predicted 2321
9 SASI_Rn02_00285467 predicted 6437
10 SASI_Rn02_00285468 predicted 5100
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389499 predicted 3748
2 SASI_Rn02_00389500 predicted 4614
3 SASI_Rn02_00389501 predicted 6616
4 SASI_Rn02_00389502 predicted 6012
5 SASI_Rn02_00389503 predicted 3990
6 SASI_Rn02_00389504 predicted 6445
7 SASI_Rn02_00389505 predicted 4906
8 SASI_Rn02_00389506 predicted 6621
9 SASI_Rn02_00389507 predicted 5109
10 SASI_Rn02_00389508 predicted 5129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183340 predicted 3236
2 SASI_Mm01_00183342 predicted 3995
3 SASI_Mm01_00183343 predicted 3738
4 SASI_Mm01_00183344 predicted 6231
5 SASI_Mm01_00183345 predicted 2519
6 SASI_Mm02_00328912 predicted 6010
7 SASI_Mm01_00183346 predicted 1874
8 SASI_Mm02_00328913 predicted 7635
9 SASI_Mm01_00183347 predicted 717
10 SASI_Mm01_00183348 predicted 5114
11 SASI_Mm01_00183341 predicted 6216
12 SASI_Mm01_00183349 predicted 4718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025730
VALIDATED
LRRK2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-1154s1c1
Sequence:CCGGCGCAGCTTTCAGCGATTCTAACTCGAGTTAGAATCGCTGAAAGCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025730.3-1954s21c1
Sequence:CCGGTCCACTTTGCAGCGCTTTAAACTCGAGTTTAAAGCGCTGCAAAGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025730.1-295s1c1
Sequence:CCGGGCTTACTACTTCACGATATTTCTCGAGAAATATCGTGAAGTAGTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-141s1c1
Sequence:CCGGGCTGCCATCATTGCGAAGATTCTCGAGAATCTTCGCAATGATGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-555s1c1
Sequence:CCGGCCTAAGAACATCATTGTTGAACTCGAGTTCAACAATGATGTTCTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025730.3-6235s21c1
Sequence:CCGGGGCTTACTACTTCACGATATTCTCGAGAATATCGTGAAGTAGTAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025730.3-7684s21c1
Sequence:CCGGAGACATCCTCGTCACTATATTCTCGAGAATATAGTGACGAGGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025730.3-7095s21c1
Sequence:CCGGCGCAGCTTTCAGCGATTCTAACTCGAGTTAGAATCGCTGAAAGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025730.3-5389s21c1
Sequence:CCGGGGCCGAGTTGTGGATCATATTCTCGAGAATATGATCCACAACTCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025730
VALIDATED
LRRK2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-1154s1c1
Sequence:CCGGCGCAGCTTTCAGCGATTCTAACTCGAGTTAGAATCGCTGAAAGCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025730.3-1954s21c1
Sequence:CCGGTCCACTTTGCAGCGCTTTAAACTCGAGTTTAAAGCGCTGCAAAGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025730.1-295s1c1
Sequence:CCGGGCTTACTACTTCACGATATTTCTCGAGAAATATCGTGAAGTAGTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-141s1c1
Sequence:CCGGGCTGCCATCATTGCGAAGATTCTCGAGAATCTTCGCAATGATGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-555s1c1
Sequence:CCGGCCTAAGAACATCATTGTTGAACTCGAGTTCAACAATGATGTTCTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025730.3-6235s21c1
Sequence:CCGGGGCTTACTACTTCACGATATTCTCGAGAATATCGTGAAGTAGTAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025730.3-7684s21c1
Sequence:CCGGAGACATCCTCGTCACTATATTCTCGAGAATATAGTGACGAGGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025730.3-7095s21c1
Sequence:CCGGCGCAGCTTTCAGCGATTCTAACTCGAGTTAGAATCGCTGAAAGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025730.3-5389s21c1
Sequence:CCGGGGCCGAGTTGTGGATCATATTCTCGAGAATATGATCCACAACTCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025730
VALIDATED
LRRK2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-1154s1c1
Sequence:CCGGCGCAGCTTTCAGCGATTCTAACTCGAGTTAGAATCGCTGAAAGCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025730.3-1954s21c1
Sequence:CCGGTCCACTTTGCAGCGCTTTAAACTCGAGTTTAAAGCGCTGCAAAGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025730.1-295s1c1
Sequence:CCGGGCTTACTACTTCACGATATTTCTCGAGAAATATCGTGAAGTAGTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-141s1c1
Sequence:CCGGGCTGCCATCATTGCGAAGATTCTCGAGAATCTTCGCAATGATGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025730.1-555s1c1
Sequence:CCGGCCTAAGAACATCATTGTTGAACTCGAGTTCAACAATGATGTTCTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025730.3-6235s21c1
Sequence:CCGGGGCTTACTACTTCACGATATTCTCGAGAATATCGTGAAGTAGTAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025730.3-7684s21c1
Sequence:CCGGAGACATCCTCGTCACTATATTCTCGAGAATATAGTGACGAGGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025730.3-7095s21c1
Sequence:CCGGCGCAGCTTTCAGCGATTCTAACTCGAGTTAGAATCGCTGAAAGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025730.3-5389s21c1
Sequence:CCGGGGCCGAGTTGTGGATCATATTCTCGAGAATATGATCCACAACTCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_058513
VALIDATED
LRRK2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat kinase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-5995s1c1
Sequence:CCGGGCCAGAGGAAATGTCATTTATCTCGAGATAAATGACATTTCCTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-6782s1c1
Sequence:CCGGCCACAAATTCAACGGAAAGAACTCGAGTTCTTTCCGTTGAATTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-7558s1c1
Sequence:CCGGCGTGTGTATGAAGGAATGTTACTCGAGTAACATTCCTTCATACACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-305s1c1
Sequence:CCGGCCCAGGATGTTGGAAATGATTCTCGAGAATCATTTCCAACATCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-2128s1c1
Sequence:CCGGCCCAAATTGGTGGAACTCTTACTCGAGTAAGAGTTCCACCAATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_058513
VALIDATED
LRRK2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat kinase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-5995s1c1
Sequence:CCGGGCCAGAGGAAATGTCATTTATCTCGAGATAAATGACATTTCCTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-6782s1c1
Sequence:CCGGCCACAAATTCAACGGAAAGAACTCGAGTTCTTTCCGTTGAATTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-7558s1c1
Sequence:CCGGCGTGTGTATGAAGGAATGTTACTCGAGTAACATTCCTTCATACACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-305s1c1
Sequence:CCGGCCCAGGATGTTGGAAATGATTCTCGAGAATCATTTCCAACATCCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-2128s1c1
Sequence:CCGGCCCAAATTGGTGGAACTCTTACTCGAGTAAGAGTTCCACCAATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_058513
VALIDATED
LRRK2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat kinase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-5995s1c1
Sequence:CCGGGCCAGAGGAAATGTCATTTATCTCGAGATAAATGACATTTCCTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-6782s1c1
Sequence:CCGGCCACAAATTCAACGGAAAGAACTCGAGTTCTTTCCGTTGAATTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-7558s1c1
Sequence:CCGGCGTGTGTATGAAGGAATGTTACTCGAGTAACATTCCTTCATACACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-305s1c1
Sequence:CCGGCCCAGGATGTTGGAAATGATTCTCGAGAATCATTTCCAACATCCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:XM_058513.8-2128s1c1
Sequence:CCGGCCCAAATTGGTGGAACTCTTACTCGAGTAAGAGTTCCACCAATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198578
VALIDATED
LRRK2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat kinase 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000368513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_198578.3-7444s21c1
Sequence:CCGGTCGTCGACTTATACGTGTAATCTCGAGATTACACGTATAAGTCGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198578.2-8921s1c1
Sequence:CCGGGATAGGACAACTAGTACATTTCTCGAGAAATGTACTAGTTGTCCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198578.3-946s21c1
Sequence:CCGGTAGGCTTACATTAGGTAATTTCTCGAGAAATTACCTAATGTAAGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198578.3-8168s21c1
Sequence:CCGGTCGAAATGCACTATCATATATCTCGAGATATATGATAGTGCATTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198578
VALIDATED
LRRK2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat kinase 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000368513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_198578.3-7444s21c1
Sequence:CCGGTCGTCGACTTATACGTGTAATCTCGAGATTACACGTATAAGTCGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198578.2-8921s1c1
Sequence:CCGGGATAGGACAACTAGTACATTTCTCGAGAAATGTACTAGTTGTCCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198578.3-946s21c1
Sequence:CCGGTAGGCTTACATTAGGTAATTTCTCGAGAAATTACCTAATGTAAGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198578.3-8168s21c1
Sequence:CCGGTCGAAATGCACTATCATATATCTCGAGATATATGATAGTGCATTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198578
VALIDATED
LRRK2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat kinase 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000368513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_198578.3-7444s21c1
Sequence:CCGGTCGTCGACTTATACGTGTAATCTCGAGATTACACGTATAAGTCGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198578.2-8921s1c1
Sequence:CCGGGATAGGACAACTAGTACATTTCTCGAGAAATGTACTAGTTGTCCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198578.3-946s21c1
Sequence:CCGGTAGGCTTACATTAGGTAATTTCTCGAGAAATTACCTAATGTAAGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198578.3-8168s21c1
Sequence:CCGGTCGAAATGCACTATCATATATCTCGAGATATATGATAGTGCATTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)