EMAIL THIS PAGE TO A FRIEND

LRRN1

leucine rich repeat neuronal 1

124 Gene Product Result for
Synonyms: FIGLER3 NLRR-1
UniProtKB ID: Q6UXK5, Q3LID5, Q8IYV5, Q9H8V1, Q9P231
Gene ID:
Mouse(16979) leucine rich repeat protein 1, neuronal
Rat(500280) leucine rich repeat neuronal 1
Zebrafish(568527) leucine rich repeat neuronal 1
cow(539619) leucine rich repeat neuronal 1
domestic cat(101098526) leucine rich repeat neuronal 1
dog(484682) leucine rich repeat neuronal 1
chicken(771599) leucine rich repeat neuronal 1
naked mole-rat(101703501) leucine rich repeat neuronal 1
domestic guinea pig(100735846) leucine rich repeat neuronal 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020873 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020873 Rosetta Predictions human pricing
NM_001037363 Rosetta Predictions rat pricing
NM_008516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354171 predicted 2398
2 SASI_Hs01_00037166 predicted 942
3 SASI_Hs02_00354172 predicted 2894
4 SASI_Hs01_00037168 predicted 2197
5 SASI_Hs01_00037169 predicted 789
6 SASI_Hs01_00037170 predicted 2521
7 SASI_Hs01_00037171 predicted 2049
8 SASI_Hs02_00354173 predicted 801
9 SASI_Hs01_00037172 predicted 2026
10 SASI_Hs02_00354174 predicted 990
11 SASI_Hs01_00037164 predicted 2467
12 SASI_Hs01_00037165 predicted 381
13 SASI_Hs01_00037167 predicted 2217
14 SASI_Hs01_00037173 predicted 2034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103026 predicted 289
2 SASI_Rn01_00103027 predicted 739
3 SASI_Rn02_00204417 predicted 675
4 SASI_Rn01_00103028 predicted 1046
5 SASI_Rn01_00103029 predicted 1061
6 SASI_Rn01_00103030 predicted 1083
7 SASI_Rn01_00103031 predicted 478
8 SASI_Rn01_00103032 predicted 2211
9 SASI_Rn01_00103033 predicted 1296
10 SASI_Rn01_00103034 predicted 1806
11 SASI_Rn01_00103035 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021299 predicted 2351
2 SASI_Mm01_00021300 predicted 1720
3 SASI_Mm01_00021301 predicted 2847
4 SASI_Mm01_00021302 predicted 1948
5 SASI_Mm01_00021303 predicted 1980
6 SASI_Mm01_00021304 predicted 1709
7 SASI_Mm01_00021305 predicted 1589
8 SASI_Mm01_00021306 predicted 1375
9 SASI_Mm01_00021307 predicted 820
10 SASI_Mm01_00021308 predicted 2129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020873
LRRN1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-2377s1c1
Sequence:CCGGCCACTCATTAACCTCTGGGAACTCGAGTTCCCAGAGGTTAATGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-846s1c1
Sequence:CCGGCCACCTGAACTCCAACAAATTCTCGAGAATTTGTTGGAGTTCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1359s1c1
Sequence:CCGGGCTGAACAACAATGCCTTGAACTCGAGTTCAAGGCATTGTTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-783s1c1
Sequence:CCGGCCACAACCAAATTAGCACTATCTCGAGATAGTGCTAATTTGGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-427s1c1
Sequence:CCGGCCACAACTTTGCGTATGTGAACTCGAGTTCACATACGCAAAGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1926s1c1
Sequence:CCGGGCAGACAGAATCCCATTCCATCTCGAGATGGAATGGGATTCTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-2266s1c1
Sequence:CCGGGCGTCCATTGCTGTGTACTTTCTCGAGAAAGTACACAGCAATGGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020873.3-2967s1c1
Sequence:CCGGGCTAGACTTGTTACCTTCGTTCTCGAGAACGAAGGTAACAAGTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1372s1c1
Sequence:CCGGGCCTTGAATGCCATTTACCAACTCGAGTTGGTAAATGGCATTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020873
LRRN1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-2377s1c1
Sequence:CCGGCCACTCATTAACCTCTGGGAACTCGAGTTCCCAGAGGTTAATGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-846s1c1
Sequence:CCGGCCACCTGAACTCCAACAAATTCTCGAGAATTTGTTGGAGTTCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1359s1c1
Sequence:CCGGGCTGAACAACAATGCCTTGAACTCGAGTTCAAGGCATTGTTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-783s1c1
Sequence:CCGGCCACAACCAAATTAGCACTATCTCGAGATAGTGCTAATTTGGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-427s1c1
Sequence:CCGGCCACAACTTTGCGTATGTGAACTCGAGTTCACATACGCAAAGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1926s1c1
Sequence:CCGGGCAGACAGAATCCCATTCCATCTCGAGATGGAATGGGATTCTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-2266s1c1
Sequence:CCGGGCGTCCATTGCTGTGTACTTTCTCGAGAAAGTACACAGCAATGGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020873.3-2967s1c1
Sequence:CCGGGCTAGACTTGTTACCTTCGTTCTCGAGAACGAAGGTAACAAGTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1372s1c1
Sequence:CCGGGCCTTGAATGCCATTTACCAACTCGAGTTGGTAAATGGCATTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020873
LRRN1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-2377s1c1
Sequence:CCGGCCACTCATTAACCTCTGGGAACTCGAGTTCCCAGAGGTTAATGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-846s1c1
Sequence:CCGGCCACCTGAACTCCAACAAATTCTCGAGAATTTGTTGGAGTTCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1359s1c1
Sequence:CCGGGCTGAACAACAATGCCTTGAACTCGAGTTCAAGGCATTGTTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-783s1c1
Sequence:CCGGCCACAACCAAATTAGCACTATCTCGAGATAGTGCTAATTTGGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-427s1c1
Sequence:CCGGCCACAACTTTGCGTATGTGAACTCGAGTTCACATACGCAAAGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1926s1c1
Sequence:CCGGGCAGACAGAATCCCATTCCATCTCGAGATGGAATGGGATTCTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-2266s1c1
Sequence:CCGGGCGTCCATTGCTGTGTACTTTCTCGAGAAAGTACACAGCAATGGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020873.3-2967s1c1
Sequence:CCGGGCTAGACTTGTTACCTTCGTTCTCGAGAACGAAGGTAACAAGTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020873.3-1372s1c1
Sequence:CCGGGCCTTGAATGCCATTTACCAACTCGAGTTGGTAAATGGCATTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008516
LRRN1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008516.1-3366s1c1
Sequence:CCGGGCTACTTTGTTGAATGATGTTCTCGAGAACATCATTCAACAAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-1025s1c1
Sequence:CCGGCCAGAACAACTTTACAAACATCTCGAGATGTTTGTAAAGTTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-1372s1c1
Sequence:CCGGGCCTAGTGTTAGCAGGAATGTCTCGAGACATTCCTGCTAACACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-2107s1c1
Sequence:CCGGGAAATAAGATAACCGTGGAAACTCGAGTTTCCACGGTTATCTTATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-2763s1c1
Sequence:CCGGCCACTCATTAACCTCTGGGAACTCGAGTTCCCAGAGGTTAATGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008516
LRRN1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008516.1-3366s1c1
Sequence:CCGGGCTACTTTGTTGAATGATGTTCTCGAGAACATCATTCAACAAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-1025s1c1
Sequence:CCGGCCAGAACAACTTTACAAACATCTCGAGATGTTTGTAAAGTTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-1372s1c1
Sequence:CCGGGCCTAGTGTTAGCAGGAATGTCTCGAGACATTCCTGCTAACACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-2107s1c1
Sequence:CCGGGAAATAAGATAACCGTGGAAACTCGAGTTTCCACGGTTATCTTATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-2763s1c1
Sequence:CCGGCCACTCATTAACCTCTGGGAACTCGAGTTCCCAGAGGTTAATGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008516
LRRN1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008516.1-3366s1c1
Sequence:CCGGGCTACTTTGTTGAATGATGTTCTCGAGAACATCATTCAACAAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-1025s1c1
Sequence:CCGGCCAGAACAACTTTACAAACATCTCGAGATGTTTGTAAAGTTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-1372s1c1
Sequence:CCGGGCCTAGTGTTAGCAGGAATGTCTCGAGACATTCCTGCTAACACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-2107s1c1
Sequence:CCGGGAAATAAGATAACCGTGGAAACTCGAGTTTCCACGGTTATCTTATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008516.1-2763s1c1
Sequence:CCGGCCACTCATTAACCTCTGGGAACTCGAGTTCCCAGAGGTTAATGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)