EMAIL THIS PAGE TO A FRIEND

LRRN2

leucine rich repeat neuronal 2

97 Gene Product Result for
Synonyms: FIGLER7 GAC1 LRANK1 LRRN5
UniProtKB ID: O75325, B2R624, Q5T0Y0, Q6UXM0, Q8N182
Gene ID:
Human(10446) Summary: The protein encoded by this gene belongs to the leucine-rich repeat superfamily. This gene was found to be amplified and overexpressed in malignant gliomas. The encoded protein has homology with other proteins that function as cell-adhesion molecules or as signal transduction receptors and is a candidate for the target gene in the 1q32.1 amplicon in malignant gliomas. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(16980) leucine rich repeat protein 2, neuronal
Rat(289020) leucine rich repeat neuronal 2
domestic guinea pig(101789278) leucine rich repeat neuronal 2
sheep(101109030) leucine rich repeat neuronal 2
chicken(428261) leucine rich repeat neuronal 2
cow(767860) leucine rich repeat neuronal 2
Horse(100054439) leucine rich repeat neuronal 2
dog(488564) leucine rich repeat neuronal 2
domestic cat(101083057) leucine rich repeat neuronal 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006338 Rosetta Predictions human pricing
NM_201630 Rosetta Predictions human pricing
XM_001060363 Rosetta Predictions rat pricing
XM_222670 Rosetta Predictions rat pricing
NM_010732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228344 predicted 2617
2 SASI_Hs01_00228345 predicted 1045
3 SASI_Hs01_00228346 predicted 803
4 SASI_Hs01_00228347 predicted 1228
5 SASI_Hs01_00228348 predicted 2709
6 SASI_Hs01_00228349 predicted 916
7 SASI_Hs01_00228350 predicted 2033
8 SASI_Hs01_00228351 predicted 490
9 SASI_Hs01_00228352 predicted 2597
10 SASI_Hs01_00228353 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210733 predicted 2604
2 SASI_Hs01_00210734 predicted 1037
3 SASI_Hs01_00210735 predicted 792
4 SASI_Hs01_00210736 predicted 1214
5 SASI_Hs01_00210737 predicted 2697
6 SASI_Hs01_00210738 predicted 910
7 SASI_Hs01_00210739 predicted 2021
8 SASI_Hs01_00210740 predicted 472
9 SASI_Hs01_00210741 predicted 2580
10 SASI_Hs01_00210742 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296206 predicted 845
2 SASI_Rn02_00296207 predicted 1513
3 SASI_Rn02_00296208 predicted 1202
4 SASI_Rn02_00296209 predicted 1453
5 SASI_Rn02_00296210 predicted 1297
6 SASI_Rn02_00296211 predicted 2251
7 SASI_Rn02_00296212 predicted 2440
8 SASI_Rn02_00296213 predicted 2226
9 SASI_Rn02_00296214 predicted 2137
10 SASI_Rn02_00296215 predicted 2073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380845 predicted 841
2 SASI_Rn02_00380846 predicted 1512
3 SASI_Rn02_00380847 predicted 1202
4 SASI_Rn02_00380848 predicted 1453
5 SASI_Rn02_00380849 predicted 1298
6 SASI_Rn02_00380850 predicted 2260
7 SASI_Rn02_00380851 predicted 2443
8 SASI_Rn02_00380852 predicted 2218
9 SASI_Rn02_00380853 predicted 2135
10 SASI_Rn02_00380854 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137669 predicted 1442
2 SASI_Mm01_00137670 predicted 2180
3 SASI_Mm01_00137671 predicted 1375
4 SASI_Mm01_00137672 predicted 1399
5 SASI_Mm01_00137673 predicted 1325
6 SASI_Mm01_00137674 predicted 764
7 SASI_Mm01_00137675 predicted 2121
8 SASI_Mm01_00137676 predicted 2363
9 SASI_Mm01_00137677 predicted 1063
10 SASI_Mm01_00137678 predicted 1369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010732
LRRN2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000108535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010732.1-2774s1c1
Sequence:CCGGCGTTGATTGATCCACGTGCTTCTCGAGAAGCACGTGGATCAATCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-1501s1c1
Sequence:CCGGCCACGGCTTTCTTTCATCCATCTCGAGATGGATGAAAGAAAGCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-1104s1c1
Sequence:CCGGGCCCAACTTGGAAATCCTCATCTCGAGATGAGGATTTCCAAGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-2152s1c1
Sequence:CCGGCCATATCACATCCTGCTGTTTCTCGAGAAACAGCAGGATGTGATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010732
LRRN2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000108535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010732.1-2774s1c1
Sequence:CCGGCGTTGATTGATCCACGTGCTTCTCGAGAAGCACGTGGATCAATCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-1501s1c1
Sequence:CCGGCCACGGCTTTCTTTCATCCATCTCGAGATGGATGAAAGAAAGCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-1104s1c1
Sequence:CCGGGCCCAACTTGGAAATCCTCATCTCGAGATGAGGATTTCCAAGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-2152s1c1
Sequence:CCGGCCATATCACATCCTGCTGTTTCTCGAGAAACAGCAGGATGTGATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010732
LRRN2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000108535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010732.1-2774s1c1
Sequence:CCGGCGTTGATTGATCCACGTGCTTCTCGAGAAGCACGTGGATCAATCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-1501s1c1
Sequence:CCGGCCACGGCTTTCTTTCATCCATCTCGAGATGGATGAAAGAAAGCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-1104s1c1
Sequence:CCGGGCCCAACTTGGAAATCCTCATCTCGAGATGAGGATTTCCAAGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010732.1-2152s1c1
Sequence:CCGGCCATATCACATCCTGCTGTTTCTCGAGAAACAGCAGGATGTGATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006338
LRRN2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-952s1c1
Sequence:CCGGGCCCAACTTGGAGATACTCATCTCGAGATGAGTATCTCCAAGTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-1280s1c1
Sequence:CCGGCTGGTCTCCATCGACAAGTTTCTCGAGAAACTTGTCGATGGAGACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-809s1c1
Sequence:CCGGGCCAGCCTACAGGAACTCTATCTCGAGATAGAGTTCCTGTAGGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-2001s1c1
Sequence:CCGGCCTATCACATCCTGCTATCTTCTCGAGAAGATAGCAGGATGTGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006338.2-2993s21c1
Sequence:CCGGAGCCAGATCTGAAGGACATTTCTCGAGAAATGTCCTTCAGATCTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-545s21c1
Sequence:CCGGGTGGACTGCAATGACCTATTCCTCGAGGAATAGGTCATTGCAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-928s21c1
Sequence:CCGGTGACAGCCGCTGGTTTGAAATCTCGAGATTTCAAACCAGCGGCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-2121s21c1
Sequence:CCGGGAACCCACAGCTACAACATTACTCGAGTAATGTTGTAGCTGTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006338
LRRN2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-952s1c1
Sequence:CCGGGCCCAACTTGGAGATACTCATCTCGAGATGAGTATCTCCAAGTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-1280s1c1
Sequence:CCGGCTGGTCTCCATCGACAAGTTTCTCGAGAAACTTGTCGATGGAGACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-809s1c1
Sequence:CCGGGCCAGCCTACAGGAACTCTATCTCGAGATAGAGTTCCTGTAGGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-2001s1c1
Sequence:CCGGCCTATCACATCCTGCTATCTTCTCGAGAAGATAGCAGGATGTGATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006338.2-2993s21c1
Sequence:CCGGAGCCAGATCTGAAGGACATTTCTCGAGAAATGTCCTTCAGATCTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-545s21c1
Sequence:CCGGGTGGACTGCAATGACCTATTCCTCGAGGAATAGGTCATTGCAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-928s21c1
Sequence:CCGGTGACAGCCGCTGGTTTGAAATCTCGAGATTTCAAACCAGCGGCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-2121s21c1
Sequence:CCGGGAACCCACAGCTACAACATTACTCGAGTAATGTTGTAGCTGTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006338
LRRN2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-952s1c1
Sequence:CCGGGCCCAACTTGGAGATACTCATCTCGAGATGAGTATCTCCAAGTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-1280s1c1
Sequence:CCGGCTGGTCTCCATCGACAAGTTTCTCGAGAAACTTGTCGATGGAGACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-809s1c1
Sequence:CCGGGCCAGCCTACAGGAACTCTATCTCGAGATAGAGTTCCTGTAGGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006338.2-2001s1c1
Sequence:CCGGCCTATCACATCCTGCTATCTTCTCGAGAAGATAGCAGGATGTGATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006338.2-2993s21c1
Sequence:CCGGAGCCAGATCTGAAGGACATTTCTCGAGAAATGTCCTTCAGATCTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-545s21c1
Sequence:CCGGGTGGACTGCAATGACCTATTCCTCGAGGAATAGGTCATTGCAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-928s21c1
Sequence:CCGGTGACAGCCGCTGGTTTGAAATCTCGAGATTTCAAACCAGCGGCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006338.2-2121s21c1
Sequence:CCGGGAACCCACAGCTACAACATTACTCGAGTAATGTTGTAGCTGTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)