EMAIL THIS PAGE TO A FRIEND

LRRN3

leucine rich repeat neuronal 3

110 Gene Product Result for
Synonyms: FIGLER5 NLRR-3 NLRR3
UniProtKB ID: Q9H3W5, O43377, Q6I9V8, Q8IYQ6
Gene ID:
Mouse(16981) leucine rich repeat protein 3, neuronal
Rat(81514) leucine rich repeat neuronal 3
Zebrafish(559559) leucine rich repeat neuronal 3
dog(482406) leucine rich repeat neuronal 3
cow(539665) leucine rich repeat neuronal 3
Horse(100055630) leucine rich repeat neuronal 3
domestic cat(101082555) leucine rich repeat neuronal 3
chicken(770169) leucine rich repeat neuronal 3
sheep(101113322) leucine rich repeat neuronal 3
domestic guinea pig(100728613) leucine rich repeat neuronal 3
naked mole-rat(101722493) leucine rich repeat neuronal 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032811 MISSION® esiRNA esiRNA human LRRN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099658 Rosetta Predictions human pricing
NM_001099660 Rosetta Predictions human pricing
NM_018334 Rosetta Predictions human pricing
NM_030856 Rosetta Predictions rat pricing
NM_010733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320896 predicted 2299
2 SASI_Hs02_00320897 predicted 1092
3 SASI_Hs02_00320898 predicted 1350
4 SASI_Hs02_00320899 predicted 1583
5 SASI_Hs02_00320900 predicted 2849
6 SASI_Hs02_00320901 predicted 1039
7 SASI_Hs02_00320902 predicted 1745
8 SASI_Hs02_00320903 predicted 1126
9 SASI_Hs02_00320904 predicted 2347
10 SASI_Hs02_00320905 predicted 2330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320906 predicted 2411
2 SASI_Hs02_00320907 predicted 1199
3 SASI_Hs02_00320908 predicted 1464
4 SASI_Hs02_00320909 predicted 1685
5 SASI_Hs02_00320910 predicted 2954
6 SASI_Hs02_00320911 predicted 1149
7 SASI_Hs02_00320912 predicted 1850
8 SASI_Hs02_00320913 predicted 1232
9 SASI_Hs02_00320914 predicted 2454
10 SASI_Hs02_00320915 predicted 2432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193983 predicted 2217
2 SASI_Hs01_00193984 predicted 1008
3 SASI_Hs01_00193985 predicted 1271
4 SASI_Hs01_00193986 predicted 1501
5 SASI_Hs01_00193987 predicted 2764
6 SASI_Hs01_00193988 predicted 955
7 SASI_Hs01_00193990 predicted 1659
8 SASI_Hs01_00193991 predicted 1045
9 SASI_Hs01_00193992 predicted 2261
10 SASI_Hs02_00351775 predicted 2243
11 SASI_Hs01_00193989 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038410 predicted 989
2 SASI_Rn01_00038411 predicted 2398
3 SASI_Rn01_00038413 predicted 979
4 SASI_Rn02_00264101 predicted 1227
5 SASI_Rn01_00038414 predicted 950
6 SASI_Rn01_00038415 predicted 2550
7 SASI_Rn01_00038416 predicted 2055
8 SASI_Rn01_00038417 predicted 1011
9 SASI_Rn01_00038418 predicted 1973
10 SASI_Rn02_00264102 predicted 773
11 SASI_Rn01_00038409 predicted 888
12 SASI_Rn01_00038412 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074966 predicted 1192
2 SASI_Mm01_00074967 predicted 1617
3 SASI_Mm01_00074968 predicted 2043
4 SASI_Mm01_00074969 predicted 2622
5 SASI_Mm01_00074970 predicted 727
6 SASI_Mm01_00074971 predicted 1658
7 SASI_Mm01_00074972 predicted 637
8 SASI_Mm01_00074973 predicted 908
9 SASI_Mm01_00074974 predicted 2245
10 SASI_Mm02_00319236 predicted 770
11 SASI_Mm01_00074965 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018334
LRRN3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018334.4-1168s21c1
Sequence:CCGCTATCTTCAGTCACCAATATTACTCGAGTAATATTGGTGACTGAAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-2771s1c1
Sequence:CCGGCCTCTGATAAATCTCTGGGAACTCGAGTTCCCAGAGATTTATCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-884s1c1
Sequence:CCGGGCATCTACAGTGGATTGTAATCTCGAGATTACAATCCACTGTAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018334.3-3186s1c1
Sequence:CCGGGAGTAGTTGAACTGAGCAATACTCGAGTATTGCTCAGTTCAACTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-1211s1c1
Sequence:CCGGGCCTTTATTGGCCTACATAATCTCGAGATTATGTAGGCCAATAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018334.3-3016s1c1
Sequence:CCGGCCTGACCAATGGAAATATGTACTCGAGTACATATTTCCATTGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018334.4-1803s21c1
Sequence:CCGGGCTACTAACAACCCTAGATTGCTCGAGCAATCTAGGGTTGTTAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018334
LRRN3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018334.4-1168s21c1
Sequence:CCGCTATCTTCAGTCACCAATATTACTCGAGTAATATTGGTGACTGAAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-2771s1c1
Sequence:CCGGCCTCTGATAAATCTCTGGGAACTCGAGTTCCCAGAGATTTATCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-884s1c1
Sequence:CCGGGCATCTACAGTGGATTGTAATCTCGAGATTACAATCCACTGTAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018334.3-3186s1c1
Sequence:CCGGGAGTAGTTGAACTGAGCAATACTCGAGTATTGCTCAGTTCAACTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-1211s1c1
Sequence:CCGGGCCTTTATTGGCCTACATAATCTCGAGATTATGTAGGCCAATAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018334.3-3016s1c1
Sequence:CCGGCCTGACCAATGGAAATATGTACTCGAGTACATATTTCCATTGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018334.4-1803s21c1
Sequence:CCGGGCTACTAACAACCCTAGATTGCTCGAGCAATCTAGGGTTGTTAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018334
LRRN3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018334.4-1168s21c1
Sequence:CCGCTATCTTCAGTCACCAATATTACTCGAGTAATATTGGTGACTGAAGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-2771s1c1
Sequence:CCGGCCTCTGATAAATCTCTGGGAACTCGAGTTCCCAGAGATTTATCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-884s1c1
Sequence:CCGGGCATCTACAGTGGATTGTAATCTCGAGATTACAATCCACTGTAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018334.3-3186s1c1
Sequence:CCGGGAGTAGTTGAACTGAGCAATACTCGAGTATTGCTCAGTTCAACTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018334.3-1211s1c1
Sequence:CCGGGCCTTTATTGGCCTACATAATCTCGAGATTATGTAGGCCAATAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018334.3-3016s1c1
Sequence:CCGGCCTGACCAATGGAAATATGTACTCGAGTACATATTTCCATTGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018334.4-1803s21c1
Sequence:CCGGGCTACTAACAACCCTAGATTGCTCGAGCAATCTAGGGTTGTTAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010733
LRRN3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-1010s21c1
Sequence:CCGGAGCCTTCATTGGCCTACATAACTCGAGTTATGTAGGCCAATGAAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-2251s21c1
Sequence:CCGGCATTTGATGTCAAGGTATATACTCGAGTATATACCTTGACATCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010733.2-2977s1c1
Sequence:CCGGCCTGTGTTGTATTACACATATCTCGAGATATGTGTAATACAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-1665s1c1
Sequence:CCGGCGCTGGATTAACATGAACAAACTCGAGTTTGTTCATGTTAATCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-2042s1c1
Sequence:CCGGCGGTGCTGATTTGAAGTCGATCTCGAGATCGACTTCAAATCAGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-626s1c1
Sequence:CCGGCCAATTATGTACCTGTGAGATCTCGAGATCTCACAGGTACATAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-1183s1c1
Sequence:CCGGGCCTGGTTATAGCTGGCATAACTCGAGTTATGCCAGCTATAACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-2631s21c1
Sequence:CCGGGCTATAGGAGTGCCGACAAATCTCGAGATTTGTCGGCACTCCTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010733
LRRN3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-1010s21c1
Sequence:CCGGAGCCTTCATTGGCCTACATAACTCGAGTTATGTAGGCCAATGAAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-2251s21c1
Sequence:CCGGCATTTGATGTCAAGGTATATACTCGAGTATATACCTTGACATCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010733.2-2977s1c1
Sequence:CCGGCCTGTGTTGTATTACACATATCTCGAGATATGTGTAATACAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-1665s1c1
Sequence:CCGGCGCTGGATTAACATGAACAAACTCGAGTTTGTTCATGTTAATCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-2042s1c1
Sequence:CCGGCGGTGCTGATTTGAAGTCGATCTCGAGATCGACTTCAAATCAGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-626s1c1
Sequence:CCGGCCAATTATGTACCTGTGAGATCTCGAGATCTCACAGGTACATAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-1183s1c1
Sequence:CCGGGCCTGGTTATAGCTGGCATAACTCGAGTTATGCCAGCTATAACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-2631s21c1
Sequence:CCGGGCTATAGGAGTGCCGACAAATCTCGAGATTTGTCGGCACTCCTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010733
LRRN3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-1010s21c1
Sequence:CCGGAGCCTTCATTGGCCTACATAACTCGAGTTATGTAGGCCAATGAAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-2251s21c1
Sequence:CCGGCATTTGATGTCAAGGTATATACTCGAGTATATACCTTGACATCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010733.2-2977s1c1
Sequence:CCGGCCTGTGTTGTATTACACATATCTCGAGATATGTGTAATACAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-1665s1c1
Sequence:CCGGCGCTGGATTAACATGAACAAACTCGAGTTTGTTCATGTTAATCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-2042s1c1
Sequence:CCGGCGGTGCTGATTTGAAGTCGATCTCGAGATCGACTTCAAATCAGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-626s1c1
Sequence:CCGGCCAATTATGTACCTGTGAGATCTCGAGATCTCACAGGTACATAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010733.2-1183s1c1
Sequence:CCGGGCCTGGTTATAGCTGGCATAACTCGAGTTATGCCAGCTATAACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010733.2-2631s21c1
Sequence:CCGGGCTATAGGAGTGCCGACAAATCTCGAGATTTGTCGGCACTCCTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)