EMAIL THIS PAGE TO A FRIEND

LRRN4

leucine rich repeat neuronal 4

72 Gene Product Result for
Synonyms: C20orf75 NLRR-4 NLRR4 dJ1056H1.1
UniProtKB ID: Q8WUT4, A8K258, Q5JWV6, Q9H419
Gene ID:
Mouse(320974) leucine rich repeat neuronal 4
Rat(311443) leucine rich repeat neuronal 4
naked mole-rat(101720945) leucine rich repeat neuronal 4
domestic guinea pig(100733256) leucine rich repeat neuronal 4
sheep(101109900) leucine rich repeat neuronal 4
chicken(427686) leucine rich repeat neuronal 4
dog(485776) leucine rich repeat neuronal 4
cow(527351) leucine rich repeat neuronal 4
domestic cat(101088828) leucine rich repeat neuronal 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152611 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152611 Rosetta Predictions human pricing
XM_001081242 Rosetta Predictions rat pricing
XM_230550 Rosetta Predictions rat pricing
NM_177303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057143 predicted 291
2 SASI_Hs01_00057144 predicted 1024
3 SASI_Hs01_00057146 predicted 1035
4 SASI_Hs01_00057147 predicted 1159
5 SASI_Hs01_00057148 predicted 1110
6 SASI_Hs01_00057150 predicted 1008
7 SASI_Hs01_00057151 predicted 1041
8 SASI_Hs01_00057152 predicted 1126
9 SASI_Hs02_00366462 predicted 903
10 SASI_Hs02_00366463 predicted 1178
11 SASI_Hs01_00057145 predicted 1008
12 SASI_Hs01_00057149 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371192 predicted 1279
2 SASI_Rn02_00371193 predicted 1318
3 SASI_Rn02_00371194 predicted 1530
4 SASI_Rn02_00371195 predicted 1309
5 SASI_Rn02_00371196 predicted 1293
6 SASI_Rn02_00371197 predicted 1447
7 SASI_Rn02_00371198 predicted 1447
8 SASI_Rn02_00371199 predicted 1327
9 SASI_Rn02_00371200 predicted 888
10 SASI_Rn02_00371201 predicted 1820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179565 predicted 791
2 SASI_Rn02_00386336 predicted 1935
3 SASI_Rn01_00179566 predicted 1142
4 SASI_Rn01_00179568 predicted 1527
5 SASI_Rn01_00179569 predicted 1309
6 SASI_Rn02_00386337 predicted 1295
7 SASI_Rn01_00179570 predicted 1160
8 SASI_Rn02_00386338 predicted 1539
9 SASI_Rn01_00179571 predicted 1760
10 SASI_Rn01_00179573 predicted 1860
11 SASI_Rn01_00179567 predicted 1928
12 SASI_Rn01_00179572 predicted 1810
13 SASI_Rn01_00179574 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171914 predicted 493
2 SASI_Mm01_00171915 predicted 1352
3 SASI_Mm01_00171916 predicted 1399
4 SASI_Mm01_00171917 predicted 886
5 SASI_Mm01_00171918 predicted 2336
6 SASI_Mm01_00171919 predicted 1093
7 SASI_Mm01_00171921 predicted 1380
8 SASI_Mm01_00171922 predicted 1524
9 SASI_Mm01_00171923 predicted 1478
10 SASI_Mm02_00347376 predicted 1526
11 SASI_Mm01_00171920 predicted 1939
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152611
LRRN4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1175s1c1
Sequence:CCGGCACGGATGCAAAGAGAACTGTCTCGAGACAGTTCTCTTTGCATCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1013s1c1
Sequence:CCGGCGCCACACACATCTTTCAAGACTCGAGTCTTGAAAGATGTGTGTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1052s1c1
Sequence:CCGGCCTTCTGTTCCAGAACTGCAACTCGAGTTGCAGTTCTGGAACAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1064s1c1
Sequence:CCGGGAACTGCAACTTGAGTTCCTTCTCGAGAAGGAACTCAAGTTGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152611.2-2549s1c1
Sequence:CCGGCCTTGAGCACACATGGAACTTCTCGAGAAGTTCCATGTGTGCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152611.2-2542s1c1
Sequence:CCGGCAGAATGCCTTGAGCACACATCTCGAGATGTGTGCTCAAGGCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1015s1c1
Sequence:CCGGCCACACACATCTTTCAAGATACTCGAGTATCTTGAAAGATGTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152611
LRRN4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1175s1c1
Sequence:CCGGCACGGATGCAAAGAGAACTGTCTCGAGACAGTTCTCTTTGCATCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1013s1c1
Sequence:CCGGCGCCACACACATCTTTCAAGACTCGAGTCTTGAAAGATGTGTGTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1052s1c1
Sequence:CCGGCCTTCTGTTCCAGAACTGCAACTCGAGTTGCAGTTCTGGAACAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1064s1c1
Sequence:CCGGGAACTGCAACTTGAGTTCCTTCTCGAGAAGGAACTCAAGTTGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152611.2-2549s1c1
Sequence:CCGGCCTTGAGCACACATGGAACTTCTCGAGAAGTTCCATGTGTGCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152611.2-2542s1c1
Sequence:CCGGCAGAATGCCTTGAGCACACATCTCGAGATGTGTGCTCAAGGCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1015s1c1
Sequence:CCGGCCACACACATCTTTCAAGATACTCGAGTATCTTGAAAGATGTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152611
LRRN4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1175s1c1
Sequence:CCGGCACGGATGCAAAGAGAACTGTCTCGAGACAGTTCTCTTTGCATCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1013s1c1
Sequence:CCGGCGCCACACACATCTTTCAAGACTCGAGTCTTGAAAGATGTGTGTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1052s1c1
Sequence:CCGGCCTTCTGTTCCAGAACTGCAACTCGAGTTGCAGTTCTGGAACAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1064s1c1
Sequence:CCGGGAACTGCAACTTGAGTTCCTTCTCGAGAAGGAACTCAAGTTGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152611.2-2549s1c1
Sequence:CCGGCCTTGAGCACACATGGAACTTCTCGAGAAGTTCCATGTGTGCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152611.2-2542s1c1
Sequence:CCGGCAGAATGCCTTGAGCACACATCTCGAGATGTGTGCTCAAGGCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152611.2-1015s1c1
Sequence:CCGGCCACACACATCTTTCAAGATACTCGAGTATCTTGAAAGATGTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177303
LRRN4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat neuronal 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1400s1c1
Sequence:CCGGCCACTAACTCTGAGCTAGTTTCTCGAGAAACTAGCTCAGAGTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-737s1c1
Sequence:CCGGCGAGCCTAGAAAGAGTTGAGTCTCGAGACTCAACTCTTTCTAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177303.4-2409s21c1
Sequence:CCGGGGCTCCAGAACTTCAATTATCCTCGAGGATAATTGAAGTTCTGGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177303.4-2706s21c1
Sequence:CCGGGGATAACAAAGCAGTTGTAAGCTCGAGCTTACAACTGCTTTGTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1217s1c1
Sequence:CCGGGCCGCTTCGATCATTCAGTTTCTCGAGAAACTGAATGATCGAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1902s1c1
Sequence:CCGGGCTCTGGTATCAGATCCACTACTCGAGTAGTGGATCTGATACCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177303.3-3193s1c1
Sequence:CCGGCCTGAATATGAATCACACTATCTCGAGATAGTGTGATTCATATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177303.4-1099s21c1
Sequence:CCGGCCATGTGTGAGCCTGCTTTAGCTCGAGCTAAAGCAGGCTCACACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177303
LRRN4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat neuronal 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1400s1c1
Sequence:CCGGCCACTAACTCTGAGCTAGTTTCTCGAGAAACTAGCTCAGAGTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-737s1c1
Sequence:CCGGCGAGCCTAGAAAGAGTTGAGTCTCGAGACTCAACTCTTTCTAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177303.4-2409s21c1
Sequence:CCGGGGCTCCAGAACTTCAATTATCCTCGAGGATAATTGAAGTTCTGGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177303.4-2706s21c1
Sequence:CCGGGGATAACAAAGCAGTTGTAAGCTCGAGCTTACAACTGCTTTGTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1217s1c1
Sequence:CCGGGCCGCTTCGATCATTCAGTTTCTCGAGAAACTGAATGATCGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1902s1c1
Sequence:CCGGGCTCTGGTATCAGATCCACTACTCGAGTAGTGGATCTGATACCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177303.3-3193s1c1
Sequence:CCGGCCTGAATATGAATCACACTATCTCGAGATAGTGTGATTCATATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177303.4-1099s21c1
Sequence:CCGGCCATGTGTGAGCCTGCTTTAGCTCGAGCTAAAGCAGGCTCACACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177303
LRRN4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat neuronal 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1400s1c1
Sequence:CCGGCCACTAACTCTGAGCTAGTTTCTCGAGAAACTAGCTCAGAGTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-737s1c1
Sequence:CCGGCGAGCCTAGAAAGAGTTGAGTCTCGAGACTCAACTCTTTCTAGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177303.4-2409s21c1
Sequence:CCGGGGCTCCAGAACTTCAATTATCCTCGAGGATAATTGAAGTTCTGGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177303.4-2706s21c1
Sequence:CCGGGGATAACAAAGCAGTTGTAAGCTCGAGCTTACAACTGCTTTGTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1217s1c1
Sequence:CCGGGCCGCTTCGATCATTCAGTTTCTCGAGAAACTGAATGATCGAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177303.3-1902s1c1
Sequence:CCGGGCTCTGGTATCAGATCCACTACTCGAGTAGTGGATCTGATACCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177303.3-3193s1c1
Sequence:CCGGCCTGAATATGAATCACACTATCTCGAGATAGTGTGATTCATATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177303.4-1099s21c1
Sequence:CCGGCCATGTGTGAGCCTGCTTTAGCTCGAGCTAAAGCAGGCTCACACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)