EMAIL THIS PAGE TO A FRIEND

LRRN4CL

LRRN4 C-terminal like

48 Gene Product Result for
UniProtKB ID: Q8ND94, A8K5L9
Gene ID:
Mouse(68852) LRRN4 C-terminal like
Rat(690329) LRRN4 C-terminal like
cow(788567) LRRN4 C-terminal like
domestic cat(101087425) LRRN4 C-terminal like
dog(100682753) LRRN4 C-terminal like
domestic guinea pig(100734524) LRRN4 C-terminal like
naked mole-rat(101725310) LRRN4 C-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU197991 MISSION® esiRNA esiRNA targeting mouse Lrrn4cl mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203422 Rosetta Predictions human pricing
NM_001109579 Rosetta Predictions rat pricing
NM_001013019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241791 predicted 934
2 SASI_Hs01_00241792 predicted 599
3 SASI_Hs01_00241793 predicted 584
4 SASI_Hs01_00241794 predicted 343
5 SASI_Hs01_00241795 predicted 938
6 SASI_Hs01_00241796 predicted 702
7 SASI_Hs01_00241797 predicted 409
8 SASI_Hs01_00241798 predicted 553
9 SASI_Hs01_00241799 predicted 586
10 SASI_Hs01_00241800 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249781 predicted 1225
2 SASI_Rn02_00249782 predicted 675
3 SASI_Rn02_00249783 predicted 811
4 SASI_Rn02_00249784 predicted 1237
5 SASI_Rn02_00249785 predicted 628
6 SASI_Rn02_00249786 predicted 1197
7 SASI_Rn02_00249787 predicted 747
8 SASI_Rn02_00249788 predicted 454
9 SASI_Rn02_00249789 predicted 986
10 SASI_Rn02_00249790 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148050 predicted 1166
2 SASI_Mm01_00148051 predicted 1190
3 SASI_Mm01_00148052 predicted 434
4 SASI_Mm02_00287141 predicted 612
5 SASI_Mm01_00148053 predicted 794
6 SASI_Mm02_00287142 predicted 1033
7 SASI_Mm01_00148054 predicted 1334
8 SASI_Mm01_00148055 predicted 1246
9 SASI_Mm01_00148056 predicted 1211
10 SASI_Mm01_00148059 predicted 897
11 SASI_Mm01_00148057 predicted 378
12 SASI_Mm01_00148058 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203422
LRRN4CL MISSION shRNA Bacterial Glycerol Stock
LRRN4 C-terminal like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1349s21c1
Sequence:CCGGTATGACCTTTGTAACCATTTACTCGAGTAAATGGTTACAAAGGTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1269s21c1
Sequence:CCGGTTTAAGCGGCCAGATAATAAACTCGAGTTTATTATCTGGCCGCTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1326s21c1
Sequence:CCGGGGATATTATTATGTGGGTATTCTCGAGAATACCCACATAATAATATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1399s1c1
Sequence:CCGGGCGAACCTATAGTAGCAGCTACTCGAGTAGCTGCTACTATAGGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-383s1c1
Sequence:CCGGCAAGACTTTGAAGAAGAGGAGCTCGAGCTCCTCTTCTTCAAAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1298s1c1
Sequence:CCGGCCTTTGCGGTTTAAGAGGATACTCGAGTATCCTCTTAAACCGCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-748s1c1
Sequence:CCGGCATTTATGTCGTTTGCGTAGTCTCGAGACTACGCAAACGACATAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-747s1c1
Sequence:CCGGGCATTTATGTCGTTTGCGTAGCTCGAGCTACGCAAACGACATAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-386s1c1
Sequence:CCGGGACTTTGAAGAAGAGGAGGCACTCGAGTGCCTCCTCTTCTTCAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1190s1c1
Sequence:CCGGGCTTGTTTAGGTCCGGTACTTCTCGAGAAGTACCGGACCTAAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203422
LRRN4CL MISSION shRNA shRNA Plasmid DNA
LRRN4 C-terminal like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1349s21c1
Sequence:CCGGTATGACCTTTGTAACCATTTACTCGAGTAAATGGTTACAAAGGTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1269s21c1
Sequence:CCGGTTTAAGCGGCCAGATAATAAACTCGAGTTTATTATCTGGCCGCTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1326s21c1
Sequence:CCGGGGATATTATTATGTGGGTATTCTCGAGAATACCCACATAATAATATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1399s1c1
Sequence:CCGGGCGAACCTATAGTAGCAGCTACTCGAGTAGCTGCTACTATAGGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-383s1c1
Sequence:CCGGCAAGACTTTGAAGAAGAGGAGCTCGAGCTCCTCTTCTTCAAAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1298s1c1
Sequence:CCGGCCTTTGCGGTTTAAGAGGATACTCGAGTATCCTCTTAAACCGCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-748s1c1
Sequence:CCGGCATTTATGTCGTTTGCGTAGTCTCGAGACTACGCAAACGACATAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-747s1c1
Sequence:CCGGGCATTTATGTCGTTTGCGTAGCTCGAGCTACGCAAACGACATAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-386s1c1
Sequence:CCGGGACTTTGAAGAAGAGGAGGCACTCGAGTGCCTCCTCTTCTTCAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1190s1c1
Sequence:CCGGGCTTGTTTAGGTCCGGTACTTCTCGAGAAGTACCGGACCTAAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203422
LRRN4CL MISSION shRNA Lentiviral Transduction Particles
LRRN4 C-terminal like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1349s21c1
Sequence:CCGGTATGACCTTTGTAACCATTTACTCGAGTAAATGGTTACAAAGGTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1269s21c1
Sequence:CCGGTTTAAGCGGCCAGATAATAAACTCGAGTTTATTATCTGGCCGCTTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203422.1-1326s21c1
Sequence:CCGGGGATATTATTATGTGGGTATTCTCGAGAATACCCACATAATAATATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1399s1c1
Sequence:CCGGGCGAACCTATAGTAGCAGCTACTCGAGTAGCTGCTACTATAGGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-383s1c1
Sequence:CCGGCAAGACTTTGAAGAAGAGGAGCTCGAGCTCCTCTTCTTCAAAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1298s1c1
Sequence:CCGGCCTTTGCGGTTTAAGAGGATACTCGAGTATCCTCTTAAACCGCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-748s1c1
Sequence:CCGGCATTTATGTCGTTTGCGTAGTCTCGAGACTACGCAAACGACATAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-747s1c1
Sequence:CCGGGCATTTATGTCGTTTGCGTAGCTCGAGCTACGCAAACGACATAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203422.1-386s1c1
Sequence:CCGGGACTTTGAAGAAGAGGAGGCACTCGAGTGCCTCCTCTTCTTCAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165356    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203422.1-1190s1c1
Sequence:CCGGGCTTGTTTAGGTCCGGTACTTCTCGAGAAGTACCGGACCTAAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013019
LRRN4CL MISSION shRNA Bacterial Glycerol Stock
LRRN4 C-terminal like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-785s21c1
Sequence:CCGGTTTGCGTGGTGGCTGCTAATGCTCGAGCATTAGCAGCCACCACGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-872s21c1
Sequence:CCGGTTGGGCCCTGTCGCAAGTTTACTCGAGTAAACTTGCGACAGGGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013019.2-2017s21c1
Sequence:CCGGTGGGTGGCTTCCACGCATATTCTCGAGAATATGCGTGGAAGCCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-591s21c1
Sequence:CCGGTCGCCTGGGAGAAGTGCAAATCTCGAGATTTGCACTTCTCCCAGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-464s21c1
Sequence:CCGGTAGCTGTCCGTTGCGACTATGCTCGAGCATAGTCGCAACGGACAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013019.1-1710s1c1
Sequence:CCGGGCACACATACATACATACATACTCGAGTATGTATGTATGTATGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013019
LRRN4CL MISSION shRNA shRNA Plasmid DNA
LRRN4 C-terminal like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-785s21c1
Sequence:CCGGTTTGCGTGGTGGCTGCTAATGCTCGAGCATTAGCAGCCACCACGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-872s21c1
Sequence:CCGGTTGGGCCCTGTCGCAAGTTTACTCGAGTAAACTTGCGACAGGGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013019.2-2017s21c1
Sequence:CCGGTGGGTGGCTTCCACGCATATTCTCGAGAATATGCGTGGAAGCCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-591s21c1
Sequence:CCGGTCGCCTGGGAGAAGTGCAAATCTCGAGATTTGCACTTCTCCCAGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-464s21c1
Sequence:CCGGTAGCTGTCCGTTGCGACTATGCTCGAGCATAGTCGCAACGGACAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013019.1-1710s1c1
Sequence:CCGGGCACACATACATACATACATACTCGAGTATGTATGTATGTATGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013019
LRRN4CL MISSION shRNA Lentiviral Transduction Particles
LRRN4 C-terminal like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-785s21c1
Sequence:CCGGTTTGCGTGGTGGCTGCTAATGCTCGAGCATTAGCAGCCACCACGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-872s21c1
Sequence:CCGGTTGGGCCCTGTCGCAAGTTTACTCGAGTAAACTTGCGACAGGGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013019.2-2017s21c1
Sequence:CCGGTGGGTGGCTTCCACGCATATTCTCGAGAATATGCGTGGAAGCCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-591s21c1
Sequence:CCGGTCGCCTGGGAGAAGTGCAAATCTCGAGATTTGCACTTCTCCCAGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013019.2-464s21c1
Sequence:CCGGTAGCTGTCCGTTGCGACTATGCTCGAGCATAGTCGCAACGGACAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013019.1-1710s1c1
Sequence:CCGGGCACACATACATACATACATACTCGAGTATGTATGTATGTATGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)