EMAIL THIS PAGE TO A FRIEND

LRRTM1

leucine rich repeat transmembrane neuronal 1

91 Gene Product Result for
UniProtKB ID: Q86UE6, A8K397, D6W5K1, Q96DN1
Gene ID:
Mouse(74342) leucine rich repeat transmembrane neuronal 1
Rat(679668) leucine rich repeat transmembrane neuronal 1
Zebrafish(570385) leucine rich repeat transmembrane neuronal 1
cow(538452) leucine rich repeat transmembrane neuronal 1
domestic cat(101083165) leucine rich repeat transmembrane neuronal 1
dog(483089) leucine rich repeat transmembrane neuronal 1
chicken(771502) leucine rich repeat transmembrane neuronal 1
naked mole-rat(101713562) leucine rich repeat transmembrane neuronal 1
domestic guinea pig(100731553) leucine rich repeat transmembrane neuronal 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155021 MISSION® esiRNA esiRNA human LRRTM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178839 Rosetta Predictions human pricing
NM_001109374 Rosetta Predictions rat pricing
NM_028880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195816 predicted 540
2 SASI_Hs01_00195817 predicted 1764
3 SASI_Hs02_00369890 predicted 861
4 SASI_Hs01_00195818 predicted 1521
5 SASI_Hs01_00195819 predicted 1048
6 SASI_Hs01_00195820 predicted 1171
7 SASI_Hs01_00195821 predicted 1639
8 SASI_Hs01_00195823 predicted 821
9 SASI_Hs01_00195824 predicted 780
10 SASI_Hs01_00195825 predicted 1559
11 SASI_Hs01_00195822 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247786 predicted 1659
2 SASI_Rn02_00247787 predicted 876
3 SASI_Rn02_00247788 predicted 2103
4 SASI_Rn02_00247789 predicted 1383
5 SASI_Rn02_00247790 predicted 1605
6 SASI_Rn02_00247791 predicted 940
7 SASI_Rn02_00247792 predicted 816
8 SASI_Rn02_00247793 predicted 1319
9 SASI_Rn02_00247794 predicted 955
10 SASI_Rn02_00247795 predicted 1590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334564 predicted 1813
2 SASI_Mm01_00190669 predicted 838
3 SASI_Mm01_00190670 predicted 2057
4 SASI_Mm01_00190671 predicted 1348
5 SASI_Mm01_00190672 predicted 1566
6 SASI_Mm01_00190673 predicted 1631
7 SASI_Mm01_00190674 predicted 890
8 SASI_Mm01_00190675 predicted 1283
9 SASI_Mm01_00190676 predicted 904
10 SASI_Mm01_00190677 predicted 779
11 SASI_Mm01_00190678 predicted 1541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178839
LRRTM1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1274s1c1
Sequence:CCGGCAGCCTCAAGTTTCTCGACATCTCGAGATGTCGAGAAACTTGAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1062s1c1
Sequence:CCGGGTTAAGGAACTCACGCTGAGTCTCGAGACTCAGCGTGAGTTCCTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178839.3-3599s1c1
Sequence:CCGGGCCTTCAAGAAGGCAGACATTCTCGAGAATGTCTGCCTTCTTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-1376s1c1
Sequence:CCGGCGACTTGGTCAAGGTGAACTTCTCGAGAAGTTCACCTTGACCAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-2183s1c1
Sequence:CCGGCTACGTTGATTACAAACCGAACTCGAGTTCGGTTTGTAATCAACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-2174s1c1
Sequence:CCGGCCAGGAATACTACGTTGATTACTCGAGTAATCAACGTAGTATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-2220s1c1
Sequence:CCGGCTGGTGATCATCAACGAGTATCTCGAGATACTCGTTGATGATCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1292s1c1
Sequence:CCGGCATCGGATACAATCAGCTCAACTCGAGTTGAGCTGATTGTATCCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-1822s21c1
Sequence:CCGGAGGGAATGCGAGGTGTGATTGCTCGAGCAATCACACCTCGCATTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178839.4-1937s21c1
Sequence:CCGGGATATGCTCCTTGACTGAAACCTCGAGGTTTCAGTCAAGGAGCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-1609s21c1
Sequence:CCGGTACGTGTCCTGGAAGTGTTTCCTCGAGGAAACACTTCCAGGACACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-548s21c1
Sequence:CCGGGGCTCTATCTGGATCACAATCCTCGAGGATTGTGATCCAGATAGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178839
LRRTM1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1274s1c1
Sequence:CCGGCAGCCTCAAGTTTCTCGACATCTCGAGATGTCGAGAAACTTGAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1062s1c1
Sequence:CCGGGTTAAGGAACTCACGCTGAGTCTCGAGACTCAGCGTGAGTTCCTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178839.3-3599s1c1
Sequence:CCGGGCCTTCAAGAAGGCAGACATTCTCGAGAATGTCTGCCTTCTTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-1376s1c1
Sequence:CCGGCGACTTGGTCAAGGTGAACTTCTCGAGAAGTTCACCTTGACCAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-2183s1c1
Sequence:CCGGCTACGTTGATTACAAACCGAACTCGAGTTCGGTTTGTAATCAACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-2174s1c1
Sequence:CCGGCCAGGAATACTACGTTGATTACTCGAGTAATCAACGTAGTATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-2220s1c1
Sequence:CCGGCTGGTGATCATCAACGAGTATCTCGAGATACTCGTTGATGATCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1292s1c1
Sequence:CCGGCATCGGATACAATCAGCTCAACTCGAGTTGAGCTGATTGTATCCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-1822s21c1
Sequence:CCGGAGGGAATGCGAGGTGTGATTGCTCGAGCAATCACACCTCGCATTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178839.4-1937s21c1
Sequence:CCGGGATATGCTCCTTGACTGAAACCTCGAGGTTTCAGTCAAGGAGCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-1609s21c1
Sequence:CCGGTACGTGTCCTGGAAGTGTTTCCTCGAGGAAACACTTCCAGGACACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-548s21c1
Sequence:CCGGGGCTCTATCTGGATCACAATCCTCGAGGATTGTGATCCAGATAGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178839
LRRTM1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1274s1c1
Sequence:CCGGCAGCCTCAAGTTTCTCGACATCTCGAGATGTCGAGAAACTTGAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1062s1c1
Sequence:CCGGGTTAAGGAACTCACGCTGAGTCTCGAGACTCAGCGTGAGTTCCTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178839.3-3599s1c1
Sequence:CCGGGCCTTCAAGAAGGCAGACATTCTCGAGAATGTCTGCCTTCTTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-1376s1c1
Sequence:CCGGCGACTTGGTCAAGGTGAACTTCTCGAGAAGTTCACCTTGACCAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-2183s1c1
Sequence:CCGGCTACGTTGATTACAAACCGAACTCGAGTTCGGTTTGTAATCAACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178839.3-2174s1c1
Sequence:CCGGCCAGGAATACTACGTTGATTACTCGAGTAATCAACGTAGTATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-2220s1c1
Sequence:CCGGCTGGTGATCATCAACGAGTATCTCGAGATACTCGTTGATGATCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178839.3-1292s1c1
Sequence:CCGGCATCGGATACAATCAGCTCAACTCGAGTTGAGCTGATTGTATCCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-1822s21c1
Sequence:CCGGAGGGAATGCGAGGTGTGATTGCTCGAGCAATCACACCTCGCATTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178839.4-1937s21c1
Sequence:CCGGGATATGCTCCTTGACTGAAACCTCGAGGTTTCAGTCAAGGAGCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-1609s21c1
Sequence:CCGGTACGTGTCCTGGAAGTGTTTCCTCGAGGAAACACTTCCAGGACACGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178839.4-548s21c1
Sequence:CCGGGGCTCTATCTGGATCACAATCCTCGAGGATTGTGATCCAGATAGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028880
LRRTM1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028880.2-2211s1c1
Sequence:CCGGCGCTCTGATTTGTTGACTGAACTCGAGTTCAGTCAACAAATCAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-2055s1c1
Sequence:CCGGCCTGGTTATCATCAACGAGTACTCGAGTACTCGTTGATGATAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-1110s1c1
Sequence:CCGGCAGCCTCAAGTTTCTCGACATCTCGAGATGTCGAGAAACTTGAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-832s1c1
Sequence:CCGGTGGCTGTATTTGGATCACAATCTCGAGATTGTGATCCAAATACAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-1446s1c1
Sequence:CCGGCCGTATTCTCAACTCCTGGAACTCGAGTTCCAGGAGTTGAGAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028880
LRRTM1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028880.2-2211s1c1
Sequence:CCGGCGCTCTGATTTGTTGACTGAACTCGAGTTCAGTCAACAAATCAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-2055s1c1
Sequence:CCGGCCTGGTTATCATCAACGAGTACTCGAGTACTCGTTGATGATAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-1110s1c1
Sequence:CCGGCAGCCTCAAGTTTCTCGACATCTCGAGATGTCGAGAAACTTGAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-832s1c1
Sequence:CCGGTGGCTGTATTTGGATCACAATCTCGAGATTGTGATCCAAATACAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-1446s1c1
Sequence:CCGGCCGTATTCTCAACTCCTGGAACTCGAGTTCCAGGAGTTGAGAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028880
LRRTM1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028880.2-2211s1c1
Sequence:CCGGCGCTCTGATTTGTTGACTGAACTCGAGTTCAGTCAACAAATCAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-2055s1c1
Sequence:CCGGCCTGGTTATCATCAACGAGTACTCGAGTACTCGTTGATGATAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-1110s1c1
Sequence:CCGGCAGCCTCAAGTTTCTCGACATCTCGAGATGTCGAGAAACTTGAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-832s1c1
Sequence:CCGGTGGCTGTATTTGGATCACAATCTCGAGATTGTGATCCAAATACAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028880.2-1446s1c1
Sequence:CCGGCCGTATTCTCAACTCCTGGAACTCGAGTTCCAGGAGTTGAGAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)