EMAIL THIS PAGE TO A FRIEND

LRRTM2

leucine rich repeat transmembrane neuronal 2

126 Gene Product Result for
UniProtKB ID: O43300, A0AVL3, A8K4U9, B7ZLN8, Q7L770
Gene ID:
Mouse(107065) leucine rich repeat transmembrane neuronal 2
Rat(685472) leucine rich repeat transmembrane neuronal 2
sheep(101112727) leucine rich repeat transmembrane neuronal 2
domestic guinea pig(101788430) leucine rich repeat transmembrane neuronal 2
naked mole-rat(101715529) leucine rich repeat transmembrane neuronal 2
Domestic Rabbit(100347390) leucine rich repeat transmembrane neuronal 2
Zebrafish(100144398) leucine rich repeat transmembrane neuronal 2
chicken(101747697) leucine rich repeat transmembrane neuronal 2
dog(481529) leucine rich repeat transmembrane neuronal 2
chicken(101669076) leucine rich repeat transmembrane neuronal 2
cow(520949) leucine rich repeat transmembrane neuronal 2
Horse(100062214) leucine rich repeat transmembrane neuronal 2
domestic cat(101089739) leucine rich repeat transmembrane neuronal 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015564 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015564 Rosetta Predictions human pricing
NM_001109469 Rosetta Predictions rat pricing
NM_178005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117158 predicted 1345
2 SASI_Hs01_00117159 predicted 636
3 SASI_Hs01_00117160 predicted 414
4 SASI_Hs01_00117162 predicted 1278
5 SASI_Hs01_00117163 predicted 928
6 SASI_Hs01_00117164 predicted 1003
7 SASI_Hs01_00117165 predicted 506
8 SASI_Hs01_00117166 predicted 949
9 SASI_Hs01_00117167 predicted 727
10 SASI_Hs02_00348118 predicted 1254
11 SASI_Hs01_00117161 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248707 predicted 447
2 SASI_Rn02_00248708 predicted 991
3 SASI_Rn02_00248709 predicted 700
4 SASI_Rn02_00248710 predicted 910
5 SASI_Rn02_00248711 predicted 1026
6 SASI_Rn02_00248712 predicted 513
7 SASI_Rn02_00248713 predicted 397
8 SASI_Rn02_00248714 predicted 716
9 SASI_Rn02_00248715 predicted 419
10 SASI_Rn02_00248716 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194148 predicted 479
2 SASI_Mm01_00194149 predicted 817
3 SASI_Mm01_00194150 predicted 1020
4 SASI_Mm01_00194151 predicted 550
5 SASI_Mm01_00194152 predicted 757
6 SASI_Mm01_00194153 predicted 457
7 SASI_Mm01_00194154 predicted 945
8 SASI_Mm01_00194156 predicted 1066
9 SASI_Mm02_00348467 predicted 746
10 SASI_Mm01_00194157 predicted 1012
11 SASI_Mm01_00194155 predicted 1932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178005
LRRTM2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1069s21c1
Sequence:CCGGACAATCAGCTGACGAAGATTACTCGAGTAATCTTCGTCAGCTGATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1860s21c1
Sequence:CCGGTCAGACCAAGGACCGTATAATCTCGAGATTATACGGTCCTTGGTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1829s21c1
Sequence:CCGGATCCCAAACACGACTCCATATCTCGAGATATGGAGTCGTGTTTGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-638s1c1
Sequence:CCGGCCAAGGACTGTATAAACTAAACTCGAGTTTAGTTTATACAGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178005.1-2370s1c1
Sequence:CCGGCCAGTATAAGAAGTAGACTTACTCGAGTAAGTCTACTTCTTATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-915s1c1
Sequence:CCGGCGAAATGGATTTGCAGGATTACTCGAGTAATCCTGCAAATCCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-1569s1c1
Sequence:CCGGGCCATCTTTACTCAGAGAGTACTCGAGTACTCTCTGAGTAAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178005
LRRTM2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1069s21c1
Sequence:CCGGACAATCAGCTGACGAAGATTACTCGAGTAATCTTCGTCAGCTGATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1860s21c1
Sequence:CCGGTCAGACCAAGGACCGTATAATCTCGAGATTATACGGTCCTTGGTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1829s21c1
Sequence:CCGGATCCCAAACACGACTCCATATCTCGAGATATGGAGTCGTGTTTGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-638s1c1
Sequence:CCGGCCAAGGACTGTATAAACTAAACTCGAGTTTAGTTTATACAGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178005.1-2370s1c1
Sequence:CCGGCCAGTATAAGAAGTAGACTTACTCGAGTAAGTCTACTTCTTATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-915s1c1
Sequence:CCGGCGAAATGGATTTGCAGGATTACTCGAGTAATCCTGCAAATCCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-1569s1c1
Sequence:CCGGGCCATCTTTACTCAGAGAGTACTCGAGTACTCTCTGAGTAAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178005
LRRTM2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1069s21c1
Sequence:CCGGACAATCAGCTGACGAAGATTACTCGAGTAATCTTCGTCAGCTGATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1860s21c1
Sequence:CCGGTCAGACCAAGGACCGTATAATCTCGAGATTATACGGTCCTTGGTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178005.4-1829s21c1
Sequence:CCGGATCCCAAACACGACTCCATATCTCGAGATATGGAGTCGTGTTTGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-638s1c1
Sequence:CCGGCCAAGGACTGTATAAACTAAACTCGAGTTTAGTTTATACAGTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178005.1-2370s1c1
Sequence:CCGGCCAGTATAAGAAGTAGACTTACTCGAGTAAGTCTACTTCTTATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-915s1c1
Sequence:CCGGCGAAATGGATTTGCAGGATTACTCGAGTAATCCTGCAAATCCATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178005.1-1569s1c1
Sequence:CCGGGCCATCTTTACTCAGAGAGTACTCGAGTACTCTCTGAGTAAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015564
LRRTM2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-798s1c1
Sequence:CCGGCCCAACTGATTAACCTGCAAACTCGAGTTTGCAGGTTAATCAGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015564.1-2523s1c1
Sequence:CCGGGCCTGGGTTAGTAGATATTATCTCGAGATAATATCTACTAACCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-1520s1c1
Sequence:CCGGGCTACAACTTATAGAGATCCACTCGAGTGGATCTCTATAAGTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-1637s1c1
Sequence:CCGGCACTTTCCTGAACCAGACAATCTCGAGATTGTCTGGTTCAGGAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-975s1c1
Sequence:CCGGGCACAAATCGTTTGCGAAGTTCTCGAGAACTTCGCAAACGATTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-665s1c1
Sequence:CCGGCAACTTACTTGGCTCCACTTACTCGAGTAAGTGGAGCCAAGTAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015564.1-3995s1c1
Sequence:CCGGGCCCAGTTCAATTCAGTTGATCTCGAGATCAACTGAATTGAACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015564
LRRTM2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-798s1c1
Sequence:CCGGCCCAACTGATTAACCTGCAAACTCGAGTTTGCAGGTTAATCAGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015564.1-2523s1c1
Sequence:CCGGGCCTGGGTTAGTAGATATTATCTCGAGATAATATCTACTAACCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-1520s1c1
Sequence:CCGGGCTACAACTTATAGAGATCCACTCGAGTGGATCTCTATAAGTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-1637s1c1
Sequence:CCGGCACTTTCCTGAACCAGACAATCTCGAGATTGTCTGGTTCAGGAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-975s1c1
Sequence:CCGGGCACAAATCGTTTGCGAAGTTCTCGAGAACTTCGCAAACGATTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-665s1c1
Sequence:CCGGCAACTTACTTGGCTCCACTTACTCGAGTAAGTGGAGCCAAGTAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015564.1-3995s1c1
Sequence:CCGGGCCCAGTTCAATTCAGTTGATCTCGAGATCAACTGAATTGAACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015564
LRRTM2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-798s1c1
Sequence:CCGGCCCAACTGATTAACCTGCAAACTCGAGTTTGCAGGTTAATCAGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015564.1-2523s1c1
Sequence:CCGGGCCTGGGTTAGTAGATATTATCTCGAGATAATATCTACTAACCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-1520s1c1
Sequence:CCGGGCTACAACTTATAGAGATCCACTCGAGTGGATCTCTATAAGTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-1637s1c1
Sequence:CCGGCACTTTCCTGAACCAGACAATCTCGAGATTGTCTGGTTCAGGAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-975s1c1
Sequence:CCGGGCACAAATCGTTTGCGAAGTTCTCGAGAACTTCGCAAACGATTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015564.1-665s1c1
Sequence:CCGGCAACTTACTTGGCTCCACTTACTCGAGTAAGTGGAGCCAAGTAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015564.1-3995s1c1
Sequence:CCGGGCCCAGTTCAATTCAGTTGATCTCGAGATCAACTGAATTGAACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)