EMAIL THIS PAGE TO A FRIEND

LRRTM3

leucine rich repeat transmembrane neuronal 3

214 Gene Product Result for
UniProtKB ID: Q86VH5, A8K2A3, Q2NKX7, Q6N0A3
Gene ID:
Mouse(216028) leucine rich repeat transmembrane neuronal 3
Rat(294380) leucine rich repeat transmembrane neuronal 3
chicken(423649) leucine rich repeat transmembrane neuronal 3
dog(489009) leucine rich repeat transmembrane neuronal 3
cow(538148) leucine rich repeat transmembrane neuronal 3
Horse(100062943) leucine rich repeat transmembrane neuronal 3
domestic cat(101086600) leucine rich repeat transmembrane neuronal 3
Domestic Rabbit(100349949) leucine rich repeat transmembrane neuronal 3
naked mole-rat(101724178) leucine rich repeat transmembrane neuronal 3
domestic guinea pig(101787315) leucine rich repeat transmembrane neuronal 3
sheep(101101950) leucine rich repeat transmembrane neuronal 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1568 Human LRRTM3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178011 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178011 Rosetta Predictions human pricing
NM_001106387 Rosetta Predictions rat pricing
NM_178678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163674 predicted 1538
2 SASI_Hs02_00369484 predicted 1249
3 SASI_Hs01_00163676 predicted 806
4 SASI_Hs01_00163675 predicted 1023
5 SASI_Hs01_00163677 predicted 876
6 SASI_Hs01_00163679 predicted 1401
7 SASI_Hs02_00369485 predicted 1444
8 SASI_Hs01_00163682 predicted 1056
9 SASI_Hs02_00369486 predicted 897
10 SASI_Hs01_00163683 predicted 1113
11 SASI_Hs01_00163678 predicted 531
12 SASI_Hs01_00163680 predicted 2065
13 SASI_Hs01_00163681 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218468 predicted 886
2 SASI_Rn02_00218469 predicted 608
3 SASI_Rn02_00218470 predicted 1305
4 SASI_Rn02_00218471 predicted 846
5 SASI_Rn02_00218472 predicted 806
6 SASI_Rn02_00218473 predicted 541
7 SASI_Rn02_00218474 predicted 2078
8 SASI_Rn02_00218475 predicted 951
9 SASI_Rn02_00218476 predicted 1470
10 SASI_Rn02_00218477 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031303 predicted 541
2 SASI_Mm01_00031304 predicted 601
3 SASI_Mm01_00031305 predicted 692
4 SASI_Mm01_00031306 predicted 845
5 SASI_Mm01_00031307 predicted 866
6 SASI_Mm01_00031308 predicted 2071
7 SASI_Mm01_00031309 predicted 1394
8 SASI_Mm01_00031310 predicted 1477
9 SASI_Mm01_00031311 predicted 971
10 SASI_Mm01_00031312 predicted 2108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178011
LRRTM3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-2765s1c1
Sequence:CCGGGCCCAGAAACCTTGACTCTAACTCGAGTTAGAGTCAAGGTTTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-2989s1c1
Sequence:CCGGGCCTTGAATTACAGCCTAGTTCTCGAGAACTAGGCTGTAATTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178011.2-1765s1c1
Sequence:CCGGCGAGCACATCTCTTTCCATAACTCGAGTTATGGAAAGAGATGTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178011.2-1228s1c1
Sequence:CCGGCCTTTACTTGCAGTGGAATAACTCGAGTTATTCCACTGCAAGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-3002s1c1
Sequence:CCGGGCCTAGTTTCTAAGCAGTGAACTCGAGTTCACTGCTTAGAAACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178011.2-730s1c1
Sequence:CCGGCCTTCGCTATAACAGCCTTCACTCGAGTGAAGGCTGTTATAGCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178011.3-2262s21c1
Sequence:CCGGGCCGAATCAGTGACCATAAACCTCGAGGTTTATGGTCACTGATTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178011.3-584s21c1
Sequence:CCGGTCAGCTGTAGCACTGGTTATACTCGAGTATAACCAGTGCTACAGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178011
LRRTM3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-2765s1c1
Sequence:CCGGGCCCAGAAACCTTGACTCTAACTCGAGTTAGAGTCAAGGTTTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-2989s1c1
Sequence:CCGGGCCTTGAATTACAGCCTAGTTCTCGAGAACTAGGCTGTAATTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178011.2-1765s1c1
Sequence:CCGGCGAGCACATCTCTTTCCATAACTCGAGTTATGGAAAGAGATGTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178011.2-1228s1c1
Sequence:CCGGCCTTTACTTGCAGTGGAATAACTCGAGTTATTCCACTGCAAGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-3002s1c1
Sequence:CCGGGCCTAGTTTCTAAGCAGTGAACTCGAGTTCACTGCTTAGAAACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178011.2-730s1c1
Sequence:CCGGCCTTCGCTATAACAGCCTTCACTCGAGTGAAGGCTGTTATAGCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178011.3-2262s21c1
Sequence:CCGGGCCGAATCAGTGACCATAAACCTCGAGGTTTATGGTCACTGATTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178011.3-584s21c1
Sequence:CCGGTCAGCTGTAGCACTGGTTATACTCGAGTATAACCAGTGCTACAGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178011
LRRTM3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-2765s1c1
Sequence:CCGGGCCCAGAAACCTTGACTCTAACTCGAGTTAGAGTCAAGGTTTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-2989s1c1
Sequence:CCGGGCCTTGAATTACAGCCTAGTTCTCGAGAACTAGGCTGTAATTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178011.2-1765s1c1
Sequence:CCGGCGAGCACATCTCTTTCCATAACTCGAGTTATGGAAAGAGATGTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178011.2-1228s1c1
Sequence:CCGGCCTTTACTTGCAGTGGAATAACTCGAGTTATTCCACTGCAAGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178011.2-3002s1c1
Sequence:CCGGGCCTAGTTTCTAAGCAGTGAACTCGAGTTCACTGCTTAGAAACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178011.2-730s1c1
Sequence:CCGGCCTTCGCTATAACAGCCTTCACTCGAGTGAAGGCTGTTATAGCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178011.3-2262s21c1
Sequence:CCGGGCCGAATCAGTGACCATAAACCTCGAGGTTTATGGTCACTGATTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178011.3-584s21c1
Sequence:CCGGTCAGCTGTAGCACTGGTTATACTCGAGTATAACCAGTGCTACAGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178678
LRRTM3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-1007s1c1
Sequence:CCGGGCTTGAGGAAGCTGCTTAGTTCTCGAGAACTAAGCAGCTTCCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-868s1c1
Sequence:CCGGCGCAGACTCAAAGAGTTGATTCTCGAGAATCAACTCTTTGAGTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-891s1c1
Sequence:CCGGGAGTTCCAACAGAATCTCCTACTCGAGTAGGAGATTCTGTTGGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178678.2-2164s1c1
Sequence:CCGGCTCTCCCATAAGTCCTTTGAACTCGAGTTCAAAGGACTTATGGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-1410s1c1
Sequence:CCGGGCTCACATTTATTGGACAAGACTCGAGTCTTGTCCAATAAATGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-605s1c1
Sequence:CCGGCTGTCTTACTGACAATGCTTTCTCGAGAAAGCATTGTCAGTAAGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178678
LRRTM3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-1007s1c1
Sequence:CCGGGCTTGAGGAAGCTGCTTAGTTCTCGAGAACTAAGCAGCTTCCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-868s1c1
Sequence:CCGGCGCAGACTCAAAGAGTTGATTCTCGAGAATCAACTCTTTGAGTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-891s1c1
Sequence:CCGGGAGTTCCAACAGAATCTCCTACTCGAGTAGGAGATTCTGTTGGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178678.2-2164s1c1
Sequence:CCGGCTCTCCCATAAGTCCTTTGAACTCGAGTTCAAAGGACTTATGGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-1410s1c1
Sequence:CCGGGCTCACATTTATTGGACAAGACTCGAGTCTTGTCCAATAAATGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-605s1c1
Sequence:CCGGCTGTCTTACTGACAATGCTTTCTCGAGAAAGCATTGTCAGTAAGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178678
LRRTM3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-1007s1c1
Sequence:CCGGGCTTGAGGAAGCTGCTTAGTTCTCGAGAACTAAGCAGCTTCCTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-868s1c1
Sequence:CCGGCGCAGACTCAAAGAGTTGATTCTCGAGAATCAACTCTTTGAGTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-891s1c1
Sequence:CCGGGAGTTCCAACAGAATCTCCTACTCGAGTAGGAGATTCTGTTGGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178678.2-2164s1c1
Sequence:CCGGCTCTCCCATAAGTCCTTTGAACTCGAGTTCAAAGGACTTATGGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-1410s1c1
Sequence:CCGGGCTCACATTTATTGGACAAGACTCGAGTCTTGTCCAATAAATGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178678.2-605s1c1
Sequence:CCGGCTGTCTTACTGACAATGCTTTCTCGAGAAAGCATTGTCAGTAAGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)