EMAIL THIS PAGE TO A FRIEND

LRRTM4

leucine rich repeat transmembrane neuronal 4

143 Gene Product Result for
UniProtKB ID: Q86VH4, Q4FZ98, Q6UXJ7
Gene ID:
Mouse(243499) leucine rich repeat transmembrane neuronal 4
Rat(500219) leucine rich repeat transmembrane neuronal 4
domestic guinea pig(100733877) leucine rich repeat transmembrane neuronal 4
naked mole-rat(101717510) leucine rich repeat transmembrane neuronal 4
Domestic Rabbit(100346351) leucine rich repeat transmembrane neuronal 4
Zebrafish(563710) leucine rich repeat transmembrane neuronal 4
chicken(419539) leucine rich repeat transmembrane neuronal 4
cow(521137) leucine rich repeat transmembrane neuronal 4
dog(483091) leucine rich repeat transmembrane neuronal 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024993 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024993 Rosetta Predictions human pricing
NM_001134746 Rosetta Predictions rat pricing
NM_178731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092838 predicted 863
2 SASI_Hs02_00357646 predicted 1466
3 SASI_Hs01_00092840 predicted 1006
4 SASI_Hs01_00092841 predicted 511
5 SASI_Hs01_00092842 predicted 1349
6 SASI_Hs01_00092843 predicted 1205
7 SASI_Hs01_00092844 predicted 963
8 SASI_Hs01_00092845 predicted 1063
9 SASI_Hs01_00092847 predicted 577
10 SASI_Hs02_00357647 predicted 1149
11 SASI_Hs01_00092839 predicted 728
12 SASI_Hs01_00092846 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258304 predicted 493
2 SASI_Rn02_00258305 predicted 558
3 SASI_Rn02_00258306 predicted 1770
4 SASI_Rn02_00258307 predicted 1873
5 SASI_Rn02_00258308 predicted 1576
6 SASI_Rn02_00258309 predicted 1380
7 SASI_Rn02_00258310 predicted 1493
8 SASI_Rn02_00258311 predicted 656
9 SASI_Rn02_00258312 predicted 836
10 SASI_Rn02_00258313 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349263 predicted 1206
2 SASI_Mm02_00349264 predicted 406
3 SASI_Mm02_00349265 predicted 1173
4 SASI_Mm01_00117635 predicted 1662
5 SASI_Mm01_00117636 predicted 1773
6 SASI_Mm02_00349266 predicted 458
7 SASI_Mm01_00117638 predicted 1393
8 SASI_Mm02_00349267 predicted 475
9 SASI_Mm02_00349268 predicted 1078
10 SASI_Mm02_00349269 predicted 1292
11 SASI_Mm01_00117631 predicted 1228
12 SASI_Mm01_00117632 predicted 1164
13 SASI_Mm01_00117633 predicted 1607
14 SASI_Mm01_00117634 predicted 1641
15 SASI_Mm01_00117637 predicted 1614
16 SASI_Mm01_00117639 predicted 1620
17 SASI_Mm01_00117640 predicted 1612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178731
LRRTM4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-649s21c1
Sequence:CCGGATTACCTATCTGCACAATAAACTCGAGTTTATTGTGCAGATAGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-554s21c1
Sequence:CCGGGGCTTTATCTTGACCATAATTCTCGAGAATTATGGTCAAGATAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178731.2-2386s1c1
Sequence:CCGGGCTCATTGTTATACCAGCATACTCGAGTATGCTGGTATAACAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.2-1233s1c1
Sequence:CCGGGTCAACACAGAACGATCACATCTCGAGATGTGATCGTTCTGTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.4-1772s1c1
Sequence:CCGGCCATGGATATATCGGTTAATGCTCGAGCATTAACCGATATATCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178731.4-3226s21c1
Sequence:CCGGACCTGTTATTAGATGGTATTTCTCGAGAAATACCATCTAATAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-1771s21c1
Sequence:CCGGACCATGGATATATCGGTTAATCTCGAGATTAACCGATATATCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.4-1049s1c1
Sequence:CCGGCCTTGCACACCTTGGATTTATCTCGAGATAAATCCAAGGTGTGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.2-1296s1c1
Sequence:CCGGCCTACCATCTTCAAACCGGATCTCGAGATCCGGTTTGAAGATGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178731
LRRTM4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-649s21c1
Sequence:CCGGATTACCTATCTGCACAATAAACTCGAGTTTATTGTGCAGATAGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-554s21c1
Sequence:CCGGGGCTTTATCTTGACCATAATTCTCGAGAATTATGGTCAAGATAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178731.2-2386s1c1
Sequence:CCGGGCTCATTGTTATACCAGCATACTCGAGTATGCTGGTATAACAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.2-1233s1c1
Sequence:CCGGGTCAACACAGAACGATCACATCTCGAGATGTGATCGTTCTGTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.4-1772s1c1
Sequence:CCGGCCATGGATATATCGGTTAATGCTCGAGCATTAACCGATATATCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178731.4-3226s21c1
Sequence:CCGGACCTGTTATTAGATGGTATTTCTCGAGAAATACCATCTAATAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-1771s21c1
Sequence:CCGGACCATGGATATATCGGTTAATCTCGAGATTAACCGATATATCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.4-1049s1c1
Sequence:CCGGCCTTGCACACCTTGGATTTATCTCGAGATAAATCCAAGGTGTGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.2-1296s1c1
Sequence:CCGGCCTACCATCTTCAAACCGGATCTCGAGATCCGGTTTGAAGATGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178731
LRRTM4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-649s21c1
Sequence:CCGGATTACCTATCTGCACAATAAACTCGAGTTTATTGTGCAGATAGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-554s21c1
Sequence:CCGGGGCTTTATCTTGACCATAATTCTCGAGAATTATGGTCAAGATAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178731.2-2386s1c1
Sequence:CCGGGCTCATTGTTATACCAGCATACTCGAGTATGCTGGTATAACAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.2-1233s1c1
Sequence:CCGGGTCAACACAGAACGATCACATCTCGAGATGTGATCGTTCTGTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.4-1772s1c1
Sequence:CCGGCCATGGATATATCGGTTAATGCTCGAGCATTAACCGATATATCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178731.4-3226s21c1
Sequence:CCGGACCTGTTATTAGATGGTATTTCTCGAGAAATACCATCTAATAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178731.4-1771s21c1
Sequence:CCGGACCATGGATATATCGGTTAATCTCGAGATTAACCGATATATCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.4-1049s1c1
Sequence:CCGGCCTTGCACACCTTGGATTTATCTCGAGATAAATCCAAGGTGTGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178731.2-1296s1c1
Sequence:CCGGCCTACCATCTTCAAACCGGATCTCGAGATCCGGTTTGAAGATGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024993
LRRTM4 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat transmembrane neuronal 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2976s1c1
Sequence:CCGGCCTCAAATAAAGGTGTACCTTCTCGAGAAGGTACACCTTTATTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1655s1c1
Sequence:CCGGGAGCAAGAGTATGAGCATGTTCTCGAGAACATGCTCATACTCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-879s1c1
Sequence:CCGGGCCTTCGGAAACTCATCATTTCTCGAGAAATGATGAGTTTCCGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1268s1c1
Sequence:CCGGGATTCCAACAAGCTCACCAATCTCGAGATTGGTGAGCTTGTTGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1364s1c1
Sequence:CCGGCGGAGCATTTGTCCTTTATTTCTCGAGAAATAAAGGACAAATGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2961s1c1
Sequence:CCGGCCCTTTCTGTAACAGCCTCAACTCGAGTTGAGGCTGTTACAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1149s1c1
Sequence:CCGGGCCAAGGTTTGACATGGACTTCTCGAGAAGTCCATGTCAAACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2962s1c1
Sequence:CCGGCCTTTCTGTAACAGCCTCAAACTCGAGTTTGAGGCTGTTACAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024993
LRRTM4 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat transmembrane neuronal 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2976s1c1
Sequence:CCGGCCTCAAATAAAGGTGTACCTTCTCGAGAAGGTACACCTTTATTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1655s1c1
Sequence:CCGGGAGCAAGAGTATGAGCATGTTCTCGAGAACATGCTCATACTCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-879s1c1
Sequence:CCGGGCCTTCGGAAACTCATCATTTCTCGAGAAATGATGAGTTTCCGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1268s1c1
Sequence:CCGGGATTCCAACAAGCTCACCAATCTCGAGATTGGTGAGCTTGTTGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1364s1c1
Sequence:CCGGCGGAGCATTTGTCCTTTATTTCTCGAGAAATAAAGGACAAATGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2961s1c1
Sequence:CCGGCCCTTTCTGTAACAGCCTCAACTCGAGTTGAGGCTGTTACAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1149s1c1
Sequence:CCGGGCCAAGGTTTGACATGGACTTCTCGAGAAGTCCATGTCAAACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2962s1c1
Sequence:CCGGCCTTTCTGTAACAGCCTCAAACTCGAGTTTGAGGCTGTTACAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024993
LRRTM4 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat transmembrane neuronal 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2976s1c1
Sequence:CCGGCCTCAAATAAAGGTGTACCTTCTCGAGAAGGTACACCTTTATTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1655s1c1
Sequence:CCGGGAGCAAGAGTATGAGCATGTTCTCGAGAACATGCTCATACTCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-879s1c1
Sequence:CCGGGCCTTCGGAAACTCATCATTTCTCGAGAAATGATGAGTTTCCGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1268s1c1
Sequence:CCGGGATTCCAACAAGCTCACCAATCTCGAGATTGGTGAGCTTGTTGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1364s1c1
Sequence:CCGGCGGAGCATTTGTCCTTTATTTCTCGAGAAATAAAGGACAAATGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2961s1c1
Sequence:CCGGCCCTTTCTGTAACAGCCTCAACTCGAGTTGAGGCTGTTACAGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024993.3-1149s1c1
Sequence:CCGGGCCAAGGTTTGACATGGACTTCTCGAGAAGTCCATGTCAAACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024993.3-2962s1c1
Sequence:CCGGCCTTTCTGTAACAGCCTCAAACTCGAGTTTGAGGCTGTTACAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)