EMAIL THIS PAGE TO A FRIEND

LRTM1

leucine-rich repeats and transmembrane domains 1

35 Gene Product Result for
UniProtKB ID: Q9HBL6, Q8IUU2
Gene ID:
Mouse(319476) leucine-rich repeats and transmembrane domains 1
cow(101903093) leucine-rich repeats and transmembrane domains 1
naked mole-rat(101712233) leucine-rich repeats and transmembrane domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA013839 Anti-LRTM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134531 MISSION® esiRNA esiRNA human LRTM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020678 Rosetta Predictions human pricing
NM_176920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353668 predicted 702
2 SASI_Hs01_00119298 predicted 506
3 SASI_Hs01_00119299 predicted 269
4 SASI_Hs01_00119300 predicted 197
5 SASI_Hs01_00119301 predicted 572
6 SASI_Hs01_00119302 predicted 376
7 SASI_Hs01_00119303 predicted 286
8 SASI_Hs01_00119304 predicted 738
9 SASI_Hs02_00353669 predicted 684
10 SASI_Hs01_00119305 predicted 965
11 SASI_Hs01_00119297 predicted 773
12 SASI_Hs01_00119306 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346806 predicted 568
2 SASI_Mm01_00071413 predicted 497
3 SASI_Mm01_00071414 predicted 618
4 SASI_Mm01_00071415 predicted 591
5 SASI_Mm01_00071417 predicted 1055
6 SASI_Mm02_00346807 predicted 918
7 SASI_Mm01_00071418 predicted 1219
8 SASI_Mm01_00071419 predicted 835
9 SASI_Mm01_00071420 predicted 1026
10 SASI_Mm01_00071421 predicted 724
11 SASI_Mm01_00071416 predicted 911
12 SASI_Mm01_00071422 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020678
LRTM1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and transmembrane domains 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020678.2-937s21c1
Sequence:CCGGTCTTGGAGTGCGAGCTCAAACCTCGAGGTTTGAGCTCGCACTCCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020678.2-207s21c1
Sequence:CCGGTGTTACTGTCAGTCATCTACACTCGAGTGTAGATGACTGACAGTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-258s1c1
Sequence:CCGGGCCGAAATCCCTTCCCATTTACTCGAGTAAATGGGAAGGGATTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-465s1c1
Sequence:CCGGCTTTCCCTGGAAAGCAGACTTCTCGAGAAGTCTGCTTTCCAGGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-674s1c1
Sequence:CCGGCCTCTGGAAATGCAATTGCCACTCGAGTGGCAATTGCATTTCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-748s1c1
Sequence:CCGGCAGACGGCATCATCTGTGAATCTCGAGATTCACAGATGATGCCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-716s1c1
Sequence:CCGGGCTGGAGAAATTTGTCTATAACTCGAGTTATAGACAAATTTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-512s1c1
Sequence:CCGGGCTTGATTTGTCATCAAACAACTCGAGTTGTTTGATGACAAATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-292s1c1
Sequence:CCGGGAACGCTGCATTTACAAGATACTCGAGTATCTTGTAAATGCAGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020678
LRTM1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and transmembrane domains 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020678.2-937s21c1
Sequence:CCGGTCTTGGAGTGCGAGCTCAAACCTCGAGGTTTGAGCTCGCACTCCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020678.2-207s21c1
Sequence:CCGGTGTTACTGTCAGTCATCTACACTCGAGTGTAGATGACTGACAGTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-258s1c1
Sequence:CCGGGCCGAAATCCCTTCCCATTTACTCGAGTAAATGGGAAGGGATTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-465s1c1
Sequence:CCGGCTTTCCCTGGAAAGCAGACTTCTCGAGAAGTCTGCTTTCCAGGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-674s1c1
Sequence:CCGGCCTCTGGAAATGCAATTGCCACTCGAGTGGCAATTGCATTTCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-748s1c1
Sequence:CCGGCAGACGGCATCATCTGTGAATCTCGAGATTCACAGATGATGCCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-716s1c1
Sequence:CCGGGCTGGAGAAATTTGTCTATAACTCGAGTTATAGACAAATTTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-512s1c1
Sequence:CCGGGCTTGATTTGTCATCAAACAACTCGAGTTGTTTGATGACAAATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-292s1c1
Sequence:CCGGGAACGCTGCATTTACAAGATACTCGAGTATCTTGTAAATGCAGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020678
LRTM1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and transmembrane domains 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020678.2-937s21c1
Sequence:CCGGTCTTGGAGTGCGAGCTCAAACCTCGAGGTTTGAGCTCGCACTCCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020678.2-207s21c1
Sequence:CCGGTGTTACTGTCAGTCATCTACACTCGAGTGTAGATGACTGACAGTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-258s1c1
Sequence:CCGGGCCGAAATCCCTTCCCATTTACTCGAGTAAATGGGAAGGGATTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-465s1c1
Sequence:CCGGCTTTCCCTGGAAAGCAGACTTCTCGAGAAGTCTGCTTTCCAGGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-674s1c1
Sequence:CCGGCCTCTGGAAATGCAATTGCCACTCGAGTGGCAATTGCATTTCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020678.2-748s1c1
Sequence:CCGGCAGACGGCATCATCTGTGAATCTCGAGATTCACAGATGATGCCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-716s1c1
Sequence:CCGGGCTGGAGAAATTTGTCTATAACTCGAGTTATAGACAAATTTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-512s1c1
Sequence:CCGGGCTTGATTTGTCATCAAACAACTCGAGTTGTTTGATGACAAATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020678.2-292s1c1
Sequence:CCGGGAACGCTGCATTTACAAGATACTCGAGTATCTTGTAAATGCAGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176920
LRTM1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and transmembrane domains 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-548s1c1
Sequence:CCGGGCTCTTGCATTTCAATCTGTACTCGAGTACAGATTGAAATGCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-1345s1c1
Sequence:CCGGGATGGGAAGTAAGGAACTTATCTCGAGATAAGTTCCTTACTTCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-636s1c1
Sequence:CCGGGACTTCCACATTTGCGGGTTTCTCGAGAAACCCGCAAATGTGGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176920.2-1164s1c1
Sequence:CCGGCCAAACCCAAACCAAAGCCAACTCGAGTTGGCTTTGGTTTGGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-680s1c1
Sequence:CCGGCTTTCCATAGAAAGCAGCTTTCTCGAGAAAGCTGCTTTCTATGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-627s1c1
Sequence:CCGGCTTTCTATGGACTTCCACATTCTCGAGAATGTGGAAGTCCATAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176920.2-1336s1c1
Sequence:CCGGGTCTGAGAAGATGGGAAGTAACTCGAGTTACTTCCCATCTTCTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176920
LRTM1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and transmembrane domains 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-548s1c1
Sequence:CCGGGCTCTTGCATTTCAATCTGTACTCGAGTACAGATTGAAATGCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-1345s1c1
Sequence:CCGGGATGGGAAGTAAGGAACTTATCTCGAGATAAGTTCCTTACTTCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-636s1c1
Sequence:CCGGGACTTCCACATTTGCGGGTTTCTCGAGAAACCCGCAAATGTGGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176920.2-1164s1c1
Sequence:CCGGCCAAACCCAAACCAAAGCCAACTCGAGTTGGCTTTGGTTTGGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-680s1c1
Sequence:CCGGCTTTCCATAGAAAGCAGCTTTCTCGAGAAAGCTGCTTTCTATGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-627s1c1
Sequence:CCGGCTTTCTATGGACTTCCACATTCTCGAGAATGTGGAAGTCCATAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176920.2-1336s1c1
Sequence:CCGGGTCTGAGAAGATGGGAAGTAACTCGAGTTACTTCCCATCTTCTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176920
LRTM1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and transmembrane domains 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-548s1c1
Sequence:CCGGGCTCTTGCATTTCAATCTGTACTCGAGTACAGATTGAAATGCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-1345s1c1
Sequence:CCGGGATGGGAAGTAAGGAACTTATCTCGAGATAAGTTCCTTACTTCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-636s1c1
Sequence:CCGGGACTTCCACATTTGCGGGTTTCTCGAGAAACCCGCAAATGTGGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176920.2-1164s1c1
Sequence:CCGGCCAAACCCAAACCAAAGCCAACTCGAGTTGGCTTTGGTTTGGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-680s1c1
Sequence:CCGGCTTTCCATAGAAAGCAGCTTTCTCGAGAAAGCTGCTTTCTATGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176920.2-627s1c1
Sequence:CCGGCTTTCTATGGACTTCCACATTCTCGAGAATGTGGAAGTCCATAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176920.2-1336s1c1
Sequence:CCGGGTCTGAGAAGATGGGAAGTAACTCGAGTTACTTCCCATCTTCTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)