EMAIL THIS PAGE TO A FRIEND

LRTM2

leucine-rich repeats and transmembrane domains 2

55 Gene Product Result for
UniProtKB ID: Q8N967, A7E2U6
Gene ID:
Mouse(211187) leucine-rich repeats and transmembrane domains 2
Rat(680883) leucine-rich repeats and transmembrane domains 2
naked mole-rat(101723289) leucine-rich repeats and transmembrane domains 2
domestic guinea pig(100721123) leucine-rich repeats and transmembrane domains 2
Zebrafish(557289) leucine-rich repeats and transmembrane domains 2
chicken(101749866) leucine-rich repeats and transmembrane domains 2
chicken(101666468) leucine-rich repeats and transmembrane domains 2
cow(100297677) leucine-rich repeats and transmembrane domains 2
Horse(100049988) leucine-rich repeats and transmembrane domains 2
domestic cat(101085295) leucine-rich repeats and transmembrane domains 2
dog(100684881) leucine-rich repeats and transmembrane domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039029 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039029 Rosetta Predictions human pricing
NM_001109430 Rosetta Predictions rat pricing
NM_172492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205894 predicted 753
2 SASI_Hs01_00205895 predicted 1806
3 SASI_Hs01_00205896 predicted 898
4 SASI_Hs01_00205897 predicted 892
5 SASI_Hs01_00205898 predicted 2067
6 SASI_Hs01_00205900 predicted 1140
7 SASI_Hs02_00308415 predicted 1627
8 SASI_Hs01_00205901 predicted 1525
9 SASI_Hs01_00205902 predicted 1863
10 SASI_Hs01_00205903 predicted 2070
11 SASI_Hs01_00205899 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248327 predicted 1579
2 SASI_Rn02_00248328 predicted 1803
3 SASI_Rn02_00248329 predicted 1422
4 SASI_Rn02_00248330 predicted 1080
5 SASI_Rn02_00248331 predicted 1995
6 SASI_Rn02_00248332 predicted 859
7 SASI_Rn02_00248333 predicted 1695
8 SASI_Rn02_00248334 predicted 1040
9 SASI_Rn02_00248335 predicted 1057
10 SASI_Rn02_00248336 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344060 predicted 2072
2 SASI_Mm01_00163075 predicted 1286
3 SASI_Mm01_00163076 predicted 1694
4 SASI_Mm01_00163077 predicted 1536
5 SASI_Mm01_00163078 predicted 2209
6 SASI_Mm01_00163079 predicted 2294
7 SASI_Mm01_00163080 predicted 1911
8 SASI_Mm01_00163081 predicted 2218
9 SASI_Mm02_00344061 predicted 1355
10 SASI_Mm01_00163082 predicted 2313
11 SASI_Mm01_00163083 predicted 1822
12 SASI_Mm01_00163084 predicted 2383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172492
LRTM2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and transmembrane domains 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172492.2-2602s1c1
Sequence:CCGGGATGTCATTATGTCCCTTTATCTCGAGATAAAGGGACATAATGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-2016s1c1
Sequence:CCGGGATCAGAAGCAGATCTCGTCTCTCGAGAGACGAGATCTGCTTCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-1351s1c1
Sequence:CCGGCACTACTTAGACATCTGGATTCTCGAGAATCCAGATGTCTAAGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172492.2-2510s1c1
Sequence:CCGGCCAGCTCTTAGCCAATGTGAACTCGAGTTCACATTGGCTAAGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-1667s1c1
Sequence:CCGGGATGTTTAACTACTGTTCCCACTCGAGTGGGAACAGTAGTTAAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172492.2-1928s1c1
Sequence:CCGGCTGCATCTACGCATCTCTCATCTCGAGATGAGAGATGCGTAGATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172492
LRTM2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and transmembrane domains 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172492.2-2602s1c1
Sequence:CCGGGATGTCATTATGTCCCTTTATCTCGAGATAAAGGGACATAATGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-2016s1c1
Sequence:CCGGGATCAGAAGCAGATCTCGTCTCTCGAGAGACGAGATCTGCTTCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-1351s1c1
Sequence:CCGGCACTACTTAGACATCTGGATTCTCGAGAATCCAGATGTCTAAGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172492.2-2510s1c1
Sequence:CCGGCCAGCTCTTAGCCAATGTGAACTCGAGTTCACATTGGCTAAGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-1667s1c1
Sequence:CCGGGATGTTTAACTACTGTTCCCACTCGAGTGGGAACAGTAGTTAAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172492.2-1928s1c1
Sequence:CCGGCTGCATCTACGCATCTCTCATCTCGAGATGAGAGATGCGTAGATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172492
LRTM2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and transmembrane domains 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172492.2-2602s1c1
Sequence:CCGGGATGTCATTATGTCCCTTTATCTCGAGATAAAGGGACATAATGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-2016s1c1
Sequence:CCGGGATCAGAAGCAGATCTCGTCTCTCGAGAGACGAGATCTGCTTCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-1351s1c1
Sequence:CCGGCACTACTTAGACATCTGGATTCTCGAGAATCCAGATGTCTAAGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172492.2-2510s1c1
Sequence:CCGGCCAGCTCTTAGCCAATGTGAACTCGAGTTCACATTGGCTAAGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172492.2-1667s1c1
Sequence:CCGGGATGTTTAACTACTGTTCCCACTCGAGTGGGAACAGTAGTTAAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172492.2-1928s1c1
Sequence:CCGGCTGCATCTACGCATCTCTCATCTCGAGATGAGAGATGCGTAGATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039029
LRTM2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and transmembrane domains 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1316s21c1
Sequence:CCGGAGCTCAGCTGGGCTGGATATTCTCGAGAATATCCAGCCCAGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1155s21c1
Sequence:CCGGGTAACCTGCGTGAGTTCAAACCTCGAGGTTTGAACTCACGCAGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039029.1-2284s21c1
Sequence:CCGGATGCTCCTGGATTCGCTAATTCTCGAGAATTAGCGAATCCAGGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1077s21c1
Sequence:CCGGATCTGGACCGGCTGACATTTGCTCGAGCAAATGTCAGCCGGTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-901s21c1
Sequence:CCGGTGAGCTTCAGCTGCGCAATAACTCGAGTTATTGCGCAGCTGAAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039029
LRTM2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and transmembrane domains 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1316s21c1
Sequence:CCGGAGCTCAGCTGGGCTGGATATTCTCGAGAATATCCAGCCCAGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1155s21c1
Sequence:CCGGGTAACCTGCGTGAGTTCAAACCTCGAGGTTTGAACTCACGCAGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039029.1-2284s21c1
Sequence:CCGGATGCTCCTGGATTCGCTAATTCTCGAGAATTAGCGAATCCAGGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1077s21c1
Sequence:CCGGATCTGGACCGGCTGACATTTGCTCGAGCAAATGTCAGCCGGTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-901s21c1
Sequence:CCGGTGAGCTTCAGCTGCGCAATAACTCGAGTTATTGCGCAGCTGAAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039029
LRTM2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and transmembrane domains 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1316s21c1
Sequence:CCGGAGCTCAGCTGGGCTGGATATTCTCGAGAATATCCAGCCCAGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1155s21c1
Sequence:CCGGGTAACCTGCGTGAGTTCAAACCTCGAGGTTTGAACTCACGCAGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039029.1-2284s21c1
Sequence:CCGGATGCTCCTGGATTCGCTAATTCTCGAGAATTAGCGAATCCAGGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-1077s21c1
Sequence:CCGGATCTGGACCGGCTGACATTTGCTCGAGCAAATGTCAGCCGGTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039029.1-901s21c1
Sequence:CCGGTGAGCTTCAGCTGCGCAATAACTCGAGTTATTGCGCAGCTGAAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)